... Cengage Learning, Inc 12 HIPAA is the acronym for: a Health Incorporated for Patients Assistance for Allstate b Health Insurance Portability and Accountability Act c Health Insurance for Patients ... following are legitimate ethical codes? a American Association of Marriage and Family Therapy (AAMFT) Code of Ethics b Psychological Association (APA) Ethical Principles of Psychologists and Code ... Individuals have no impact on their surrounding context c Any change in any part of self affects the total individual, but not others d Any change in any part of self affects the total individual and...
... Neurological Fatigue Index for MND (NFI-MND) is a simple, easy-toadminister fatigue scale It consists of an 8-item fatigue summary scale in addition to separate scales for measuring fatigue experienced as ... model (Table 3, Analysis 6) Principal component analysis revealed that 52.09% of the variance infatigue was explained by the summary scale Individual item fit statistics for the summary scale are ... clinicians in assessing what patients mean when they describe feelings of fatigue As such 16 the NFI-MND fatigue scale may serve as a valuable tool for assessing the patient experience of fatigue...
... JP, Shapiro S, Bar-Or A, Robinson A, Le Cruguel JP, Ducruet T, Narayanan S, Arcelin K, Wong AN, Tartaglia MC, Lapierre Y, Caramanos Z, Da Costa D: Fatiguein multiple sclerosis: association with ... willingness in taking part in this study; Dr Richard Nicholas and Dr Omar Malik, of Imperial College Healthcare Trust, for allowing the approach of patients under their care; and Dave Watling and ... qualitative approaches, introduced a detailed definition of fatigue and a scale with an original item set reflecting that definition [6] No a priori assumptions regarding the dimensionality of fatigue...
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC Institutional arrangements for managing the marine environment is fragmented in most ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management...
... Binh, Nguyen Anh Tuan, Nguyen Huy Binh excitation Our new spectrometry system shows many advantages for studying Raman and Fluorescence spectra as well as weak optical signal spectra in general ... system we can now obtain weak optical signals, for example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed ... and may be set between and 30 Communications with the SR830 uses ASCII characters Commands may be in either upper or lower case and may contain any number of embedded space characters A command...
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... yeast strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways,...
... best available infrastructure, facilitating accountability, and promoting descriptive data on early child development and related Statistical Significance social factors and make them available ... Health Conditions 36 Breastfeeding 38 Family Functioning Reading to Young Children and Available Reading Materials in the Home 42 Parental Warmth and Affection 44 Child Maltreatment 46 Aggravated ... interactions such as The National Education Goals Panel120 has recommended dressing and eating may be of particular importance.126 that policymakers consider increasing the availability and intensity...
... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression consensus sequence (including ATG) ... H2O2 in the treated leaves was measured The relative increase in H2O2 in riboflavin-treated zones was calculated in comparison with the H2O-treated zones in the same leaves An area of 3–5 cm2 in...
... swift transformation taking place in the global economy makes occupation cluster analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages ... coatings that provide wear-resistance and water-proofing for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what ... normally fail In contrast, public investments that are the product of open participation and strategic thinking can create sustainable transformations The Who: Building a Leadership Team Capable...
... Matsuki M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking ... 95–103 17 Candi E, Oddi S, Terrinoni A, Paradisi A, Ranalli M, Finazzi-Agro A & Melino G (2001) Transglutaminase cross-links loricrin, involucrin, and small proline-rich proteins in vitro J Biol ... Fleckman P, Dale BA & Maki M (2003) Analysis of epidermal-type transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol...
... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... utilizing will [1] J Bear and P Price Prosody, syntax, and parsing In Proceedings of the ~8th annual A CL, 1990 [2] R Helzerman and M.P Harper Parsec: An architecture for parallel parsing of...
... This way, the students will learn and apply the strategies in the real writing task and the chance that they are going to memorize, generalize, and maintain them is increased A plan for evaluating ... Language Learning: Defining the Field and Effecting Change, Franfurt: Peter Lang, 1999 [5] P Benson, Autonomy in language teaching and learning, Language Teaching 40 (2006) 21 [6] D Little, Language ... is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the...
... developing the GIS ecotourism database for Ba Vi in ArcView includes data collection, data input, data management, data analysis and data output. The data collection involved surveying and ... by creating a GIS database that allows efficient ecotourism related data input, management, analysis and output. 3. Data and methods 3.1. Data The data used to build the GIS database for ecotourism ... for ecotourism planning and management in Ba Vi can be found at both the district departments and the national park management board. This study is an attempt to deal with such a problem by creating a GIS database that allows efficient ...
... Remarks Introduction 1.1 Research Background O Job satisfaction plays an important role in managing human resource strategies of organizations It can be said that the importance of effective managing ... one of an important factor that necessity for determining an individual performance (Pushpakumari, M D 2008) O To date, research on job satisfaction and job performance had particular interested ... 2.Literature Reviews 2.6 Job Characteristics and Job Satisfaction O According to Jubdi, Samah, and Saad (2007) found that there is a relationship between job characteristics and motivation, satisfaction,...
... compare with any place It has many overlapping mountains In large mountains, there are many famous natural caves attracting thousands of visitors every year such as Cua Quan, Van, and Vo mountains, ... also conserves national cultural and historical values Developing economy and society ina sustainable way in trade villages is a new direction and a major challenge for many trade villages in ... mainly in rural markets Therefore, in trade villages, the artisans are also the farmers In addition to farming time, having a secondary job in their native land is a great advantage for people...
... of unloaded pedaling, followed by pedaling against increasing resistance until exhaustion (RAMP protocol) and ended by pedaling with low resistance The rate of work rate increase was estimated ... et al Journal of Translational Medicine 2010, 8:93 http://www.translational-medicine.com/content/8/1/93 presence of a disease that is generally accepted as an actual cause of fatigue Several ... activity according to Srere [23] and protein concentration by the Bio-Rad DC protein assay (Bio-Rad Laboratories) with bovine serum albumine as a standard The ATP synthesis rate was expressed as nmol...
... mortality, improving maternal health and combating HIV, malaria and other diseases The attainment of these goals has been hampered by the lack of skilled and well-informed health care workers in ... clearly defined penalties for plagiarism and collusion Quality assurance of approval and review processes Aim To maintain the academic quality of courses and ensure that courses remain relevant in the ... that outlines the principles of quality assurance in higher education ina simple and practical way that would enable institutions in developing countries to adapt these principles in accordance...
... The FACT-G Social Well-being scale comprises mainly items regarding social support rather than participation in social acitivities The finding that at baseline patients in the surgical treatment ... Giannantoni A, Di Stasi S, Cucchi A, Mearini E, Bini V, Porena M: Pelvic Floor Muscle Behaviour During Valsalva Leak Point Pressure Measurement in Males and Females Affected by Stress Urinary Incontinence ... scales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and less embarrassment are accompanied by better emotional and functional well-being Not assessed...
... interview and the parents agreed to allow their child to participate, they were scheduled for an interview date At the time of the interview, a trained research assistant obtained parental informed ... rescue medication, and the types of medications the child was taking These demographic characteristics are described in Table We applied a sampling scheme that allowed each participant to be interviewed ... and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, and can accurately respond to items using a 7-day recall period Feedback from the...