de nition of known and novel genes across a genomic region
Báo cáo khoa học: Definition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx
... Ggly and ApoTf (A) Binding of Glu fi Ala mutants of Ggly to ApoTf was assessed by competition with radiolabeled Ggly(2–17) in a covalent crosslinking assay A representative analysis of the interaction ... first demonstrated over 20 years ago [14,15] Although evidence was obtained for a complex between two molecules of Gamide and 4870 ApoTf, no association was observed between Gamide and iron-loaded ... serum transferrin saturation and serum Gamide concentrations [17] On the basis of these data, we suggested a mechanism, based on the well -known fact that efficient loading of ApoTf requires an anion...
- 9
- 543
- 0
Báo cáo y học: "Systematic bioinformatic analysis of expression levels of 17,330 human genes across 9,783 samples from 175 types of healthy and pathological tissues" ppt
... normalized together The detailed contents of the database are described in Additional data files and Each sample was systematically manually annotated with detailed information (when available) ... estimated from the log2-transformed values of the entire dataset (Additional data file 1) The estimated parameters were a mean of and standard deviation of This step of the sample-wise normalization ... analysis of human genes across many microarray datasets Genome Res 2004, 14:1085-1094 Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM: ONCOMINE: a...
- 14
- 211
- 0
Báo cáo hóa học: " Research Article On Definition of a Formal Model for IEC 61499 Function Blocks" pdf
... formulas de ned over a domain of input, output, and internal variables, and input event variables According to the standard, the EC condition can contain no more than one EI variable; Values of ... respectively A data valve is a functional element having one input and one output events and more than zero data inputs and outputs The number of data inputs has to be equal to that of data outputs ... and associated data buffer; (iv) for each data output of a composite block, there is a data buffer; (v) no variables are introduced for data inputs and outputs of subapplications; (vi) each constant...
- 10
- 289
- 0
Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf
... network and memory arbiter This has been implemented and it has been shown capable of executing practical UAV applications SHARING FPGA COMPUTING AND POWER RESOURCES ACROSS A SWARM OF UAVs Sharing a ... facilitate this, each node maintains a list of agents currently at its locale Nodes periodically exchange or update peers so that a global snapshot of agents is available at each node When an agent wishes ... considered a rectangular region, and hardware tasks are polygons de ning an area which contain the resources necessary to run a particular task, the allocation problem can be reduced to a geometric...
- 12
- 392
- 0
AMYLOIDOSIS – AN INSIGHT TO DISEASE OF SYSTEMS AND NOVEL THERAPIES docx
... -chain Acys Cystatin C ALys Lysozyme AApoAI Apolipoprotein AI AApoAI Apolipoprotein AI AApoAII Apolipoprotein AII AApoAII Apolipoprotein AII ATTR Transthyretin ATTR Transthyretin AGel Gelsolin AGel ... Uretral and bladder amyloidosis are rare and present with pain and hematuria Amyloid deposits in the wall of blood vessel may lead to vascular fragility, impaired hemostasis, and bleeding (70) Amyloid ... Tocilizumab for the Treatment of AA Amyloidosis 155 Toshio Tanaka, Keisuke Hagihara, Yoshihiro Hishitani and Atsushi Ogata Chapter 12 Cardiac and Multi-Organ Transplantation in Patients with Amyloidosis...
- 204
- 295
- 0
AMYLOIDOSIS – AN INSIGHT TO DISEASE OF SYSTEMS AND NOVEL THERAPIES pot
... -chain Acys Cystatin C ALys Lysozyme AApoAI Apolipoprotein AI AApoAI Apolipoprotein AI AApoAII Apolipoprotein AII AApoAII Apolipoprotein AII ATTR Transthyretin ATTR Transthyretin AGel Gelsolin AGel ... Uretral and bladder amyloidosis are rare and present with pain and hematuria Amyloid deposits in the wall of blood vessel may lead to vascular fragility, impaired hemostasis, and bleeding (70) Amyloid ... Tocilizumab for the Treatment of AA Amyloidosis 155 Toshio Tanaka, Keisuke Hagihara, Yoshihiro Hishitani and Atsushi Ogata Chapter 12 Cardiac and Multi-Organ Transplantation in Patients with Amyloidosis...
- 204
- 370
- 0
Báo cáo toán học: "An alternative definition of the notion valuation in the theory of near polygons" pot
... , A1 3 } → N satisfying Property (∗) Let A5 , A6 and A7 be those points of A such that {A1 , A2 , A5 , A7 } and {A3 , A4 , A6 , A7 } are lines of A Then de ne µ (A1 ) = µ (A2 ) = µ (A3 ) = µ (A4 ... 4.11]) then a so-called glued near polygon A1 ⊗ A2 can be derived from A1 and A2 Let x be an arbitrary point of A1 ⊗ A2 and let L be a set of lines through x forming a subspace of L (A1 ⊗ A2 , x) ... in G1 , G2 coincides with L This proves that all local spaces of A1 × A2 are regular (VII) Let A1 and A2 be two dense near polygons of diameter at least If A1 and A2 satisfy certain nice conditions...
- 14
- 338
- 0
Báo cáo y học: "Impaired expression of mitochondrial and adipogenic genes in adipose tissue from a patient with acquired partial lipodystrophy (Barraquer-Simons syndrome): a case report" pot
... manuscript RRG, EG and II performed the analysis and interpretation of data in relation to renal and liver function, cytogenetic analysis and blood analysis EGA and ALA carried out muscle analysis ... the analysis and interpretation of mitochondrial DNA data and JG and MG analyzed the mRNA FV designed and coordinated the study and was responsible 14 15 16 Senior B, Gellis SS: The syndromes of ... mRNA levels of retinoblastoma protein pRb, a protein that may have negative effects on adipogenesis [9], and of Pref-1, a known negative regulator of adipogenesis [10] were also unchanged Among...
- 6
- 329
- 0
Báo cáo y học: " Transcriptional profiling of MnSOD-mediated lifespan extension in Drosophila reveals a species-general network of aging and metabolic genes" pot
... resistance NBW and RLL designed and carried out aconitase assays, and DFolk and TJB designed and carried out CO2 production and dessication-resistance assays CC, DA, DS, and ST designed and carried ... Sohal RS, Agarwal A, Agarwal S, Orr WC: Simultaneous overexpression of copper- and zinc-containing superoxide dismutase and catalase retards age-related oxidative damage and increases metabolic ... (5'-TGCAGTCGAATAAAACGCAGATATGTTCG-3') and MnSOD2R (5'TTAACCATGGTTAAATAATCGGCGTTGAA-3') Both products were generated using pfu DNA polymerase (Stratagene, San Diego, CA, USA) Products MnSOD-1 and MnSOD-2...
- 27
- 258
- 0
Báo cáo sinh học: "Analysis of PDE6D and PDE6G genes for generalised progressive retinal atrophy (gPRA) mutations in dogs" ppt
... Location (bp) a CCGTCTGCGAGGCTCCGC ACAGTTTGAAGCCCTTCAGG TCGTGGCACTTAGCAGATAG CACCAGGGACAGACAAGTC AGAAATTGGATGAACCTCCGG ACAACAACACATGCTGTG CTGTAGCTATCTCTGTGACT CCTTCTAGGCATTGCCCTTT AGCCCGTGTTCCCAAGAAAA ... CCTTCTAGGCATTGCCCTTT AGCCCGTGTTCCCAAGAAAA ACGTTAGCACACTGGCGG GAATGGTTCTTCGAGTTTGG ACAGAAGTCAGTAACCT GGTTCTAAGTGGGTGCATGT CATTATGTAATAATAATATCAGTC Forward primer reverse primer (5 -3 ) 109 PCR amplicon length (bp) ... Location (bp) a GAGCACACCCGTGACCCT CCGGCTGCTCTGGCCCCT ACCACCTGGGCTGGGGA CTGGAACCAGGAGACCCAGG GGTGGTGCCTGGGCATCT ACCCTGCTCAAGGGCAA CTGCCTGACCCAGGTGGA CCCAATTCCTGGGTAGCC CCTGTGTCCCCGCATGCA CGGGAGAGTTGGGGGATC...
- 12
- 435
- 0
Báo cáo y học: "Identification of ciliary and ciliopathy genes in Caenorhabditis elegans through comparative genomics" pptx
... expression_analysis_manual.pdf] Affymetrix Data Analysis Fundamentals Manual [http:// www.affymetrix.com/support/downloads/manuals/ data_analysis_fundamentals_manual.pdf] Barrett T, Edgar R: Mining ... values for all 50 X-box-regulated candidate genes shows a prominent peak at a PCC of about 0.8, suggesting that a large portion of our candidate X-box regulated genes (Additional data file 2) are positively ... 5' GAAAAAAAAGTATTTGTAACG3' and M04C9.5R2 5' GGATATTTCAGCACCATGAG 3' Microinjection was performed as described [57] Briefly, 50 ng/μl of rescuing construct along with 100 ng/μl of pCeh361 (a dpy-5...
- 12
- 326
- 0
Báo cáo y học: " Phylogenetic classification of Escherichia coli O157:H7 strains of human and bovine origin using a novel set of nucleotide polymorphisms" pps
... Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H: Complete genome sequence of enterohemorrhagic ... containing all targeted polymorphisms was prepared for assay design and multiplexing by MassARRAY® assay design software as recommended by the manufacturer (Sequenom, Inc., San Diego, CA, USA) A ... O157:H7 strains in cattle Proc Natl Acad Sci USA 1999, 96:13288-13293 Ohnishi M, Terajima J, Kurokawa K, Nakayama K, Murata T, Tamura K, Ogura Y, Watanabe H, Hayashi T: Genomic diversity of enterohemorrhagic...
- 12
- 242
- 0
the syntactic and lexical features of english and vietnamese newspaper headlines a contrastive analysis = phân tích đối chiếu các đặc điểm cú pháp và từ vựng của các tiêu đề bài báo tiếng anh và tiếng việt
... differences and similarities 2.3 Data analysis The analysis of data was conducted in two stages In both stages, a detailed analysis of the corpus of 227 English and 232 Vietnamese headlines at lexical and ... of the day, and some ideas of its relative impact and importance.” (Danuta R.,1998:14) 16 Danuta R says that headline plays conflicting roles which is carrying information and attracting readers‟ ... is a subordinate one and the second is the main in the English example and vice versa in the Vietnamese one The subordinate clauses are always dependent upon the main clause and cannot stand as...
- 58
- 1,795
- 22
ASSOCIATION OF CETP AND ADTRP GENES WITH CORONARY ARTERY DISEASE IN MULTI ETHNIC SINGAPOREAN POPULATION
... 101,000 deaths each year is attributed to MI and according to Ministry of Health, Labor and Welfare of Japan, the total number of Japanese affect by CAD is 910,000 and nearly 50,000 people die annually ... The incidence and mortality of CAD also increases with age The data from National Center for Health Statistics showed that the incidence of CAD dramatically increases in men over 45 years and in ... Various races often demonstrate varying degree of morbidity and mortality from CAD In the United States, a study revealed that male blacks had less hazard of CAD mortality than male whites, whereas...
- 108
- 264
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... preclinical and clinical trial work along this line of inquiry Education and educational research What becomes obvious is that a lack of research has impact and implications for the education of both ... musculoskeletal origin Chiropractic and medical participants both noted lack of formal clinical studies examining effectiveness of manual/manipulative approaches to manage (diagnose and treat) musculoskeletal ... treatment outcome) and their preferences will also impact provider perceptions and interprofessional relationships (5) Best practices and standardization of care Participants reported that standardizing...
- 10
- 788
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... [38] or anti-HA (Sigma) Gels were dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors ... protein: facts, hypotheses and expectations Folia Biol 49, 1–8 22 Ichimiya S, Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function Pathol ... pp 1–68 Academic Press Inc., San Diego 28 Takahara PM, Rosenzweig AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug...
- 14
- 597
- 0
Traffic-related air pollution associated with prevalence of asthma and COPD/chronic bronchitis. A cross-sectional study in Southern Sweden pdf
... drafts AA: Wrote part of the manuscript and made major revisions of drafts All authors read and approved the final manuscript Acknowledgements Overall, our results show that traffic-related air ... background Descriptive data of regional air pollution at a monitoring station in a rural area Annual mean concentrations of traffic-related pollutants measured at Vavihill 1985–2006 Data source: IVL Swedish ... populated part of the county of Scania The study area contains 840 000 of Sweden's total population of 8.9 million, and has a population density of 170 inhabitants per km2 (data from 2000) The majority...
- 15
- 374
- 1
nanoplates of snwo4 and snw3o9 prepared via a facile hydrothermal
... structure replication and application as a methane gas sensor, Adv Funct Mater 19 (2009) 653–661 [17] E Matijevic, Preparation and characterization of well de ned powders and their applications in ... air (Rair ) and in air–gas mixtures (Rgas ) under the same operating current The gas response magnitude (S) was de ned as the ratio of Rair to Rgas (S = Rair /Rgas ) 2.1 Syntheses Results and discussion ... discussion Nanocrystalline ␣-SnWO4 and SnW3 O9 were prepared by the hydrothermal method All of the reactants and solvents were analytical grade and were used without further purifications In a typical...
- 6
- 499
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... Hernandez-Fernaud and E Salido Proteome changes in primary hyperoxaluria and males develop calcium oxalate crystalluria and calculi in the urine bladder, although no deposits in the renal parenchyma ... Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; Fah, ... indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the rat,...
- 9
- 481
- 0
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt
... interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the people Language and Artificial Intelligence, Makoto Nagao ... the details, Kamei and Wakao 1992) Based on both intuitive analyses and the result of the survey, we have esta, blished four major patterns, and several sub-groups for the first pattern (Locating) ... of this kind of survey An analysis based on actual data allows us to establish a clear set of patterns and sub-groups, for example to decide whether we require either Producer-For-Product (Lakoff...
- 3
- 453
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25