create a gui tool to enumerate group memberships
Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot
... build a paralog/paralogon database EPGD [9], we found it was very necessary to develop a new software that could overcome those weaknesses Here, we publish it as a complete Java package named ... degenerated homology Compared with previous tools, it has at least three significant advantages: (1) it has comprised search algorithm, statistical validation and result display in a uniform platform; ... Molecular Biology 2009, 4:2 Java package and GUI for visualization CHSMiner is characterized by its graphical interface (Figure 2A) and several convenient features for end users include: i Automatic...
- 7
- 271
- 0
Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf
... string Called BuildCnnStr, the function can be seen in Listing 7.1 This function takes a server and database names passed to it and returns a connection string You will want to create a basic module ... string that connects you to the SQL Server, allowing you access to the databases LoginSecure Flag that specifies that you want to connect to the SQL Server using a trusted connection Databases Collection ... establishing an instance of the SQL-DMO application, the code calls the ListAvailableSQLServer method If no names are loaded into the oNames namelist object (meaning that they were not available or you...
- 10
- 477
- 0
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps
... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison ... Hakkila et al [13] used similar indices to ASIX to estimate branch amount Table II Calculation of branch thickness with a special Asix Initial spacing “narrow spaced” “medium spaced” “wide spaced” ... characterised by a subatlantic climate with an annual precipitation of 700 mm and a mean annual temperature of 14.5 °C The soil is a poor sandy pleistocene podsolic cambisol (FAO) The plots have...
- 8
- 315
- 1
Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx
... non-parametric alternatives were used To evaluate the capacity to significantly discriminate the scores of the three groups, the non-parametric KruskallWallis test was applied The non-parametric ... on each question are added to obtain a total score for the test With SCTs, a theoretical score of 100 would mean that the person had answered each item in the same way that the majority of panel ... clinical judgment and may need to take remedial action The study has several limitations It addresses only three specific areas of radiation oncology, and participants come from a limited geographic...
- 6
- 392
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
... data analysis JP and EO wrote the first manuscript draft and all authors read and approved the final manuscript Acknowledgements The approach presented in this study may provide an evaluative tool ... the active contraction likely recruited a substantial number of gamma-motoneurons because gamma-motoneurons are coactivated with alpha-motoneurons even at a low level of force [17] Hutton et al ... that might serve as a global measure of neuromuscular function and reveal differences between normal subjects and those who respond to spinal manipulation As a first step toward this goal and as...
- 7
- 211
- 0
Building a Survey Tool to Assess Consumers’ Perception and Behavior Towards Green Consumption
... green packaging and influential factors - Group of 7.1 and 7.2: green waste treatment and influential factors - Group 8: Acts of propaganda about the green consumption The influential factors are ... the data analysis, but also as a means to guide the respondents to gradually approach the central questions Because the survey relates to green consumption behavior and green products, which are ... 5(6), 2006, 491-503 [16] Haron, S .A. , Paim, L and Yahaya, N., Towards sustainable consumption: An examination of environmental knowledge among Malaysians International Journal of Consumers Studies,...
- 9
- 249
- 0
A Group Introduction Activity to Create a Safe Atmosphere
... campus She has a roommate from Canada, and is happy to have a chance to practice English on a daily basis There are four in her family: herself, her father, mother and older sister, who's graduating ... designed to create a safe atmosphere, in which each student has a stake in the successful completion of each oral assignment It is important to me as a teacher that the class become a unified ... time available, teachers may choose to give students prepared handout for interviews, or have the students create their own questions to ask and areas to explore It is possible for each group...
- 4
- 381
- 0
How to create a yum
... /mnt/dvd/Server/createrepo-0.4.11-3.el5.noarch.rpm Create yum repository Create metadata • Create yum repository: # cd /mnt/ # createrepo Define yum repository Create yum repository define file /etc/yum.repos.d/dvdiso.repo: [MailRepo] name=MailRepo ... Find and install 'createrepo' package in /mnt directory: # find /mnt -iname 'createrepo*' /mnt/dvd/Server/createrepo-0.4.11-3.el5.noarch.rpm # rpm -ivh /mnt/dvd/Server/createrepo-0.4.11-3.el5.noarch.rpm ... /etc/yum.repos.d/dvdiso.repo: [MailRepo] name=MailRepo baseurl=file:///mnt/ enabled=1 gpgcheck=0 Test it # yum clean all # yum list If 'yum list' list all packages in DVD/CD disks or ISO images, it works :) ...
- 2
- 626
- 0
How to create a Raid Device using Madadm
... of partitions of sda5,sda6,sda7 This is how we can create a Raid device with level ***RAID 1*** #mdadm create /dev/md0 level=1 raid-devices=2 /dev/sda{5,6} This is how we can create a Raid ... distributed in all If one hard disk fails, data on that can be regenerated by the data and parity information in the other two hard disks ###RAID### Raid :need disks Raid :need disks Raid :need disks ... thus increasing the read performance But can be utilize only 50% of the total size Level 5: It is a combination of striping and parity Need at least three hard disks Both parity and data are distributed...
- 3
- 953
- 0
How to Create a Compelling Company Story That Inspires Employees to Excel
... usually an ad campaign or program to catch public attention There is nothing wrong with that approach except that it is usually just that—an annual advertising campaign and not the actual story ... professionally managed stage? I If you are professionally managed, what action must you take to avoid bureaucracy? I If you are a bureaucracy, what action must you take to break out of the lethargy? ... internal story is directed toward the management of the organization and the total workforce The internal How to Create a Compelling Company Story story is developed and presented by the management...
- 24
- 627
- 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx
... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... synchronicity, and it happens because like attracts like ORGANISED PLANNING There is a popular saying that goes: If you fail to plan, you plan to fail 40 A good plan must be SMART (Specific goals, Measurable ... who can and will help you along the way to achieving your goals Remember to have an attitude of gratitude towards those who help you, no matter how small the favour may be Maintain also an attitude...
- 59
- 770
- 3
Tài liệu To create a Microsoft SQL Server database for OPN Systemô XT Server pptx
... system Navigate to Database > Connection and add a new database handler for Microsoft SQL Server Click Save to add the database handler to the configuration Navigate to Database > Selection and select ... database required login information when connecting to the database sql scripts Each of the database types has a sql file that you need to: Modify to point to the right database Run to create ... port) Database: (left blank / database is created via the opn_mysql.sql script) How to create a Microsoft SQL Server database for the OPN System™ XT Server? Connecting to an Oracle database When...
- 10
- 579
- 0
Tài liệu 11 steps to create a successful web site doc
... option to automatically show products one of these online that are related to those already in your marketplaces can be a good customer’s cart, and make it easy to way to gauge demand, pricing add ... start of a paragraph, there is also a closing tag – in this case , for end of paragraph – that includes the slash mark / The italics tag means “emphasis,” and means boldface ... WYSIWYG/HTML, image maps, photo and graphics libraries; ready -to- use Java scripts; ActiveX; flash animation; Windows Media player, Quicktime, Real Audio and other plug-in support; PayPal shopping cart;...
- 64
- 558
- 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf
... use the Data Form Wizard to create a form that accesses the Customers and Orders tables in the Northwind database: Select Project ➣ Add New Item Select Data Form Wizard from the Templates section ... button to proceed Now you enter the DataSet object you want to use in your form You can pick an existing DataSet, or you can create a new one Because this is a new project, you'll be creating a ... data connection Click the Next button to continue You now log in to the database by specifying the password for the database user You used the sa user when creating the database connection earlier,...
- 5
- 502
- 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc
... child table are displayed in a DataGrid control o o o o o Cancel All The Cancel All button allows you to undo any changes you've made to the current row Add The Add button allows you to add a new ... the Customers table so that it didn't appear on your form I asked you to this so that you can now see how to manually add a control and bind it to the City column That way, you can see how to build ... forms that access the database Follow these steps to add a label and a text box to your form: Add a label below the Address label in your form Set the Name property for your new label to lblCity...
- 7
- 444
- 0
Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx
... Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and create a data table Then set the ' data source of the data ... columns A great enhancement to this tool would be to allow the user to choose multiple tables and have the application figure out the relationship between tables and create joins automatically In ... btnView button is clicked, the string is passed to a DataAdapter control, filling a data table From there, the data is displayed when the data source of the DataGrid control is set to the data table...
- 10
- 383
- 0
Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc
... text and create a data table; then set the ' data source of the data grid odaDisplay = New OleDb.OleDbDataAdapter(Me.txtSQLString.Text, mcnn) odaDisplay.Fill(dtDisplay) Me.dgDisplay.DataSource ... on multiple tables and automatically create the join Add a list of columns for the user to choose to use for criteria, and allow the user to input the criteria Use this tool as a base for editing ... columns are then added to the SQL Select string that is created and stored in txtSQLString When the btnView button is clicked, the string is passed to a DataAdapter control, filling a data table...
- 9
- 490
- 0
11 lessons from microsofts initiative to create a sustainable service culture
... They and their managers need to be committed, rewarded and recognized People want to great work, they want to know they make an impact that is measurable and appreciated Find advocat es or champions ... are times when speed is more important than quality, for example And the reverse can be true, even for the same person on the same day Simply said, to create value, you need to understand what ... each team is dependent on others to deliver a great experience It also allows you to be intentional about the experience you want to deliver It is easy to focus on what you specifically own, and...
- 2
- 352
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
- 12
- 616
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008