cord blood as a source of hematopoietic progenitors for transplantation
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... Liotta F, Andreini A, Santarlasci V, Mazzinghi B, Pizzolo G, Vinante F, Romagnani P, Maggi E, Romagnani S, Annunziato F: Role for interferon-gamma in the immunomodulatory activity of human bone marrow ... and subjected to quantitative polymerase chain reaction analysis The relative quantity of target mRNA levels was normalized for 18S RNA Relative levels of programmed death ligand-1 (PD-L1) (b), ... MSCs were analyzed at passages 3, 4, and (a) and IFN-gR KO MSCs were analyzed at passages and 12 (b) for expression of CD11b, CD45, and Sca-1 Likewise, other phenotypic markers were analyzed on...
- 11
- 464
- 0
IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS
... classifications exist for bone Based on their shape, bone can be classified as long bones (eg: femur, tibia, humerus, fibula), short bones (eg: carpals, metacarpals, tarsals, metatarsals), flat ... commercially available alternatives to auto and allogeneic bone grafts which possess many of the bone forming properties as human bone Ceramics, ceramics phosphates and bioactive glasses are a few ... copolymers of lactic and glycolic acid have also been frequently used as scaffold materials Many types of cells have been shown to attach and grow on these materials Neonatal rat osteoblasts have been...
- 77
- 972
- 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... 26(2):356-363 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al.: Reduced expression of the let-7 microRNAs in human lung cancers in association ... USA) Gene expression profiling Total RNA was extracted using Trizol reagent and the RNA quality was tested with the Agilent Bioanalyzer 2000 (Agilent Technologies, Santa Clara, CA) The RNA was...
- 17
- 593
- 0
báo cáo khoa học: " MicroRNAs involved in neoplastic transformation of liver cancer stem cells" pot
... GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGGC let-7i* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAG miR-20 0a* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCAGC F: GAGTGCATCTTACCGGACAGT ... GTGCAGGGTCCGAGGT miR-148b* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTGA F: GGCGCAAGTTCTGTTATACAC R: GTGCAGGGTCCGAGGT U6 CGCTTCACGAATTTGCGTGTCAT F: GCTTCGGCAGCACATATACTAAAAT R: CGCTTCACGAATTTGCGTGTCAT ... F:GGTGGAATCACTAACCACACG R: GTGCAGGGTCCGAGGT F: TAGTACTGCGCAAGCTACTGC R: GTGCAGGGTCCGAGGT miR-10b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAA miR-470* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTCT miR-34c-3p...
- 10
- 327
- 0
Báo cáo y học: " In-vivo kinetics of inhaled 5-Aminolevulinic acid-Induced Protoporphyrin IX fluorescence in bronchial tissue" pdf
... read and approved the final manuscript = normal tissue moderate dysplasia (moderate dysplasia severe dysplasia invasive tumor) mild dysplasia (inflammation hyperplasia metaplasia mild dysplasia) ... some areas of inflammation or metaplasia can generate false-positive results In this context the issue of "per lesion analysis" has to be taken Table 1: Baseline characteristics of the evaluated ... heterogeneity of 5-ALA-induced fluorescence intensity in premalignant and malignant changes may be a distinctive feature of 5-ALA metabolism as well as the patterns of tumor invasion This was also found...
- 7
- 260
- 0
Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx
... presence of latent BoHV-5 DNA, PCR assays were performed using samples from trigeminal ganglia dissected after euthanasia Viral DNA was detected in all animals from A6 63 group and in two animals from ... plaque size was observed between passage and the virus of high number of passages used to infect the bovine (data not shown) Concerning A6 63 strain, passage of A6 63 strain was also obtained after ... examine the presence of viral DNA, a polymerase chain reaction (PCR) that amplifies BoHV-5 gD gene was performed [33] PCR was also performed with a set of primers generating a 250 base pair fragment...
- 8
- 366
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... evaluation of safety and efficacy of self-assembled nanoparticles for oral insulin delivery Biomaterials 30:2329–39 Tsuchihashi, M., Harashima, H., Kiwada, H (1999) Development of a pharmacokinetic/pharmacodynamic...
- 7
- 391
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... accumulate at the early stationary phase, and its Ó FEBS 2002 steady-state level increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary ... phase and as a result of starvation E coli MC4100 was grown at 37 °C in Luria–Bertani or minimal media and the samples were withdrawn at 30-min intervals The cell density in each sample was measured ... deoxyoligonucleotide harboring a HindIII site (5¢-CCCAA GCTTTTAACGCACAACCAGCACC-3¢) as primers with E coli genomic DNA as a template and Taq polymerase (Roche Molecular Biochemicals) Next, the purified...
- 9
- 548
- 0
Báo cáo khoa học: In vivo production of catalase containing haem analogues pot
... polypeptide to form a gallium-substituted catalase protein (Ga-PP-KatA) Purification and characterization of Ga-PP-KatA The His6-tagged iron-containing (Fe-PP-KatA) and Ga-PP-KatA catalases were purified ... is the case for catalase HPII of E coli [16] Enzymatic and spectroscopic properties of Ga-PP-KatA Isolated Ga-PP-KatA showed less than 1% catalase activity as compared with Fe-PP-KatA (Table 2) ... molecular mass markers (kDa) Lane B: lg of Fe-PP-KatA Lane C: lg of Ga-PP-KatA The gel was stained for protein with Coomassie brilliant blue of a porphyrin compound completely lacked KatA antigen, as...
- 10
- 419
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... relate to interactions between Gal3p and Gal80p Model I As depicted in Fig 1, activated Gal3p enters the nucleus and binds to free as well as bound Gal80p to form Gal80p– Gal3p and DNA–Gal4p–Gal80p–Gal3p ... 1059–1066 24 Carey, M., Kakidani, H., Leatherwood, J., Mostashari, F & Ptashane, M (1989) An amino terminal fragment of Gal4p binds DNA as dimer J Mol Biol 209, 423–432 25 Nogi, Y & Fukasawa, T (1984) ... levels are observed as 48% and 40% of the maximum feasible expression for f1p and f2p, respectively As the total available Gal3p concentration in vivo is lM (Appendix), the dimerization of Gal3p...
- 11
- 490
- 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... further metabolism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation ... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease The fate of Der p was followed both at the whole-body level by autoradiography and ... eosinophilic airway inflammation [28–30] Trafficking of dendritic cells to the airways and the lung epithelium was also demonstrated to be dramatically increased in mice with an allergic airway inflammation,...
- 12
- 518
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG ... 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments were used as a combined template for the tertiary amplification, ... GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT...
- 9
- 422
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... (5¢-TGAGTGCA AGCGGTGTCTTA-3¢ (forward) and 5¢-TAGTGGTGA TGTGCCCATG-3¢ (reverse); primers for p21WAF1/CIF1: 5¢-ACAGCGATATCGAGACACTCA-3¢ (forward) and 5¢-GTGAGACACCAGAGTGCAAGA-3¢ (reverse); primers for ... primers for p53: 5¢-CACAGTCGGATATGAGCATC-3¢ (forward) and 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5¢-TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and 5¢-GCTTGACTCCA GAAGGGCTT-3¢ (reverse); ... experiments, a one-way ANOVA was performed The homogeneity of the variances was analyzed by the Levene test; in those cases in which the variances were unequal, the data were adequately transformed before...
- 9
- 508
- 0
Báo cáo Y học: In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis docx
... yeast plasma membrane ATPase by vanadate Biochim Biophys Acta 642, 173–181 36 Wach, A & Graber, P (1991) The plasma membrane H+-ATPase from yeast Effects of pH, vanadate and erythrosine B on ATP hydrolysis ... 95–100 Serrano, R (1983) In vivo glucose activation of the yeast plasma membrane ATPase FEBS Lett 156, 11–14 Eraso, P & Gancedo, C (1987) Activation of yeast plasma membrane ATPase by acid pH during ... modest (Table 2) Glucose-induced activation of yeast plasma membrane H+-ATPase shows characteristic changes in kinetic parameters such as pH optimum, Km for MgATP and Ki for vanadate Although...
- 6
- 469
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... identification and for elucidating the functional relationship between miRNA and its targets (Fig 1F) [13,24–28] Computer database programs, such as the PicTar database, offer an easy approach with ... developmental stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach of miRNA generation and ... elucidate the real function of miRNAs (Fig 1F) In general, the functional actions of miRNAs in mammalian cells, unlike plant cells, are associated with the translational inhibition of target mRNAs...
- 10
- 463
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
... et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported are the arithmetical means ± standard deviation of ... and immunoblotting analysis was performed as described above The immunoreactive material was detected and quantified as described above Assay of NOS activity NOS activity was assayed by detecting ... was only partially B Fig Levels of calpain isoforms and calpain substrates in the aorta of NMS and HMS rats treated with HSD Aliquots (100 lg protein) of brain soluble material (A) and aorta...
- 11
- 344
- 0
báo cáo hóa học:" In vivo properties of the proangiogenic peptide QK" pdf
... were evaluated by analysis of variance (ANOVA) Statistical Analysis All data are presented as the mean value ± SEM Statistical differences were determined by one-way or two-way ANOVA and Bonferroni ... http://www.translational-medicine.com/content/7/1/41 Masaki I, Yonemitsu Y, Yamashita A, Sata S, Tanii M, Komori K, Nakagawa K, Hou X, Nagai Y, Hasegawa M, Sugimachi K, Sueishi K: Angiogenic gene therapy ... hoc testing was performed where applicable A p value less than 0.05 was considered to be significant All the statistical analysis and the evaluation of data were performed using GraphPad Prism version...
- 10
- 679
- 0
Báo cáo hóa học: " In vivo evidence of htid suppressive activity on ErbB-2 in breast cancers over expressing the receptor" potx
... 5'-GTT GAC ATT CAA TCA AGC TGC-3'(sense) and 5'-CTG GGA TAT CAT GAG GTA AAC-3'(antisense), htid-I, 5'-GTT GAC ATT CAA TCA AGC TGC-3'(sense) and 3'-CCA GTG GAT CTT TTT CCA GAG -3'(antisense) and htid-S, ... sample loading and the amount of input cDNA Amplification of HGPRT was performed using the primers 5'TGA CAC TGG CAA AAC AAT GCA-3' (sense) and 5'GGT CCT TTT CAC CAG CAA GCT-3' (antisense) at ... evaluation of the staining was performed as follows: htid was scored negative when cytoplasmic staining was absent or very weak and positive when a homogeneous granular cytoplasmic staining, ranging...
- 13
- 376
- 0
báo cáo hóa học:" Function of anterior talofibular and calcaneofibular ligaments during in-vivo motion of the ankle joint complex" docx
... plantarflexion ATFL and CFL as measured at and at neutral Lengths the(PF), maximal dorsiflexion (DF) maximal Lengths of the ATFL and CFL as measured at maximal plantarflexion (PF), maximal dorsiflexion ... in-vivo articular cartilage contact areas of human talocrural joint under weightbearing conditions Osteoarthritis Cartilage 2006, 14(12):1294-301 Taser F, Shafiq Q, Ebraheim NA: Anatomy of lateral ankle ... al.[20], Rasmussen[21,22] and Bahr et al.[16] also found that the ATFL acts as a primary restraint in inversion and plantarflexion, whereas the CFL tension was increased mainly in inversion and...
- 6
- 369
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment of the ... normally had to continue, but the behaviour of the FRF, similar to the FRF evolution presented in case 2, was indicating that the stem was blocked and, as a consequence, there was a risk for fracture ... case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion of the stem...
- 10
- 542
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008