0

conversion from eq l to g dl and from g dl to eq l

Báo cáo khoa học:

Báo cáo khoa học: "Compared sensitivity of seedlings from 3 woody species (Quercus robur L, Quercus rubra L and Fagus silvatica L) to water-logging and associated root hypoxia: effects on water relations and photosynthesis" ppsx

Báo cáo khoa học

... maximal photosynthesis, and finally chlorophyll-a fluorescence to monitor photochemical efficiency of PS II MATERIAL AND METHODS Plant material Acorns of Q robur L and Q rubra L were collected ... height growth of F silvatica was slow (due to strong ramification and sympodial growth in this species) Growth was completely stopped on all species by the total (F) and partial (PF) water-logging ... 1332-1334 (1985) Ethylene and responses of plants to water-logging and submergence Ann Rev Plant Physiol 36, 145-174 Jackson MB, Hall KC (1987) Early stomatal closure in waterlogged pea plants is mediated...
  • 13
  • 293
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc

Điện - Điện tử

... 32:1089-1095 Houge G, Robaye B, Eikhom TS, Golstein J, Mellgren G, Gjertsen BT, Lanotte M, Doskeland SO: Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis Mol Cell Biol 1995, ... cell line HepG2 Figure Expression of HCV polyprotein from VV inhibits cellular and viral protein synthesis in the hepatic cell line HepG2 A: Monolayers of HepG2 cells were infected (5 PFU/cell) ... triggers apoptosis through RNase L, in a PKRindependent pathway Finally, we analysed cellular and viral protein synthesis in RNase L knockout cells expressing HCV Consequently, RL+/+ and RL-/-...
  • 19
  • 373
  • 0
báo cáo hóa học:

báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx

Hóa học - Dầu khí

... 32:1089-1095 Houge G, Robaye B, Eikhom TS, Golstein J, Mellgren G, Gjertsen BT, Lanotte M, Doskeland SO: Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis Mol Cell Biol 1995, ... cell line HepG2 Figure Expression of HCV polyprotein from VV inhibits cellular and viral protein synthesis in the hepatic cell line HepG2 A: Monolayers of HepG2 cells were infected (5 PFU/cell) ... triggers apoptosis through RNase L, in a PKRindependent pathway Finally, we analysed cellular and viral protein synthesis in RNase L knockout cells expressing HCV Consequently, RL+/+ and RL-/-...
  • 19
  • 389
  • 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Nông nghiệp

... related to sealing 117 WELLS, E C Cultural soilscapes 125 LANDA, E R From agricultural geology to hydropedotogy: forging links within the twenty-first-century geoscience community 133 HAZELTON,P ... publications of GSL and other societies worldwide, consult www.geolsoc.org.uk, or contact the Fellowship Department at: The Geological Society, Burlington House, Piccadilly, London WIJ 0BG: Tel ... on suitably qualified Fellows, and about 2000 of the Fellowship carry the title (CGeol) Chartered Geologists may also obtain the equivalent European title, European Geologist (EurGeol) One fifth...
  • 5
  • 287
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Vulnerability of young oak seedlings (Quercus robur L) to embolism: responses to drought and to an inoculation with Ophiostoma querci (Georgevitch) Nannf" potx

Báo cáo khoa học

... saplings, embolized vessel could be progressivély plugged and therefore unable to refill under pressure during our measurements This would lead to underestimates of maximal conductivity (k and ... conductance from soil to leaves, and the onset of embolism in twigs and petioles MATERIAL AND METHODS Plant material Three-year-old seedlings of Q robur L were grown in 10 L pots in a peat/sand mixture ... mmol m s MPa for inoculated and controls, respectively, which were not statistically different (Fisher PLSD, 5%) The value of g declined rapidly to very L low values during the first drought...
  • 12
  • 256
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Response of Pinus taeda L to soil flooding and salinity SR Pezeshki" ppt

Báo cáo khoa học

... soil type and regime on growth of tupelo seedlings Ecology 54, 188-193 Helal HM, Mengel K (1981) Interaction between light intensity and NaCl salinity and their effects on growth, CO assimilation ... Chimikilis and Karlander (1973), Helal and Mengel (1981),Longstreth et al (1984), Rouxel et al (1989), Hajibagheri et al (1989), Rawson et al (1988), Werner and Stelzer (1990), and Chow et al (1990) ... flooded soil on growth of pine seedlings Plant Physiol 26, 363-368 Kemp PR, Cunningham GL (1981) Light, temperature, and salinity effects on growth, leaf anatomy and photosynthesis of Distichlis...
  • 11
  • 248
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genetic markers for Prunus avium L. 2. Clonal identifications and discrimination from P cerasus and P cerasus x P avium" potx

Báo cáo khoa học

... would be of great interest On the other hand, a control of commercial plants would be possible through clone labelling in clonal seed orchards (which supply seeds for forestry plantations) and ... 4-6 pH gradient carier ampholytes were not added in the isoelectric focusing gels to - used for ACP and LAP Therefore less bands distinguishable in ACP zymograms Eleven polymorphic loci from enzyme ... For the latter loci, phenotypes numbered 1, and are genotypes aa, ab, and bb, a and b being alleles The acp2 polymorphism also seems to be under genetic control, with regard to unpublished data...
  • 9
  • 229
  • 0
NEVANLINNA THEORY FOR MEROMORPHIC MAPS FROM A CLOSED SUBMANIFOLD OF C l TO A COMPACT COMPLEX MANIFOLD

NEVANLINNA THEORY FOR MEROMORPHIC MAPS FROM A CLOSED SUBMANIFOLD OF C l TO A COMPACT COMPLEX MANIFOLD

Toán học

... space, L is the hyperplane bundle of X and Dj are hyperplanes in N -subgeneral position, we get the following Corollary 4.4 Let M be an n-dimensional closed complex submanifold of Cl and ω be ... Write g = g1 /g2 Applying Proposition 2.2 for log |g1 |, log |g2 | we get −r ∆(a, r 8n ) |∂ log |g| /∂zk | dm(z) ≤ |log |g1 g2 || sup |x−a|≤ r −r Hence, for a ∈ ∆r , | (4) −r ∆(a, r 8n ) g/ ∂zk | ... Cl to a compact complex manifold Theorem 4.3 Let M be an n-dimensional closed complex submanifold of Cl and ω be its K¨ahler form that is induced from the canonical K¨ahler form of Cl Let L...
  • 38
  • 314
  • 0
 Hiệu quả của việc bổ sung chế phẩm axit amin tổng hợp L- Lysine và DL-Methionine trong khẩu phần lợn thịt F1 (MóngCái –Yorkshire) nuôi ở trại Tiền Phong

Hiệu quả của việc bổ sung chế phẩm axit amin tổng hợp L- Lysine và DL-Methionine trong khẩu phần lợn thịt F1 (MóngCái –Yorkshire) nuôi ở trại Tiền Phong

Nông - Lâm - Ngư

... trọng l n tháng = Trọng l ợng l n cuối tháng - trọng l ợng l n đầu tháng - Khả tăng trọng l n (g/ con/ngày) = Tăng trọng l n tháng/số ngày tháng 41 - Tiêu tốn thức ăn (TTTĂ)/kg tăng trọng (kg thức ... nghiệm (có bổ sung L- Lysine DL- Methionine) có tác dụng tốt, l m tăng trọng l ợng l n cao so với l đối chứng (không bổ sung L- Lysine DL- Methionine) Như thí nghiệm l thí nghiệm có bổ sung LLysine ... sung 0,3% L- Lysine + 0,15% DL- Methionine tăng trọng l n l thí nghiệm cao so với l đối chứng Tăng trọng l n l đối chứng 389 g/ con/ngày tăng trọng l n l thí nghiệm 494 g/ con/ngày Như tăng trọng...
  • 61
  • 2,524
  • 7
Alternate strategies for conversion of waste plastic to fuels

Alternate strategies for conversion of waste plastic to fuels

Hóa học - Dầu khí

... development in this field The pyrolysis reactor must be designed to suit the mixed waste plastics and small-scaled and middlescaled production Also, analysis would help reducing the capital investment ... methanolysis, or glycolysis can be used, for example, PET (polyethylene terephthalate), polyesters, and polyamide while addition of polymers like polyolefin, polystyrene, and PVC requires stronger ... collect plastic waste the packaging and polyvinyl chloride (PVC) pipe industry are growing at 16– 18% per year The demand of plastic goods is increasing from household use to industrial applications...
  • 8
  • 537
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf

Báo cáo khoa học

... place left under right place left under right place right under left place right under left place both under S Table 1: Example C&C-CONV lexical and rule schemas can be atomic, e .g the N assigned ... parser output against gold conversion (left), and the original parser evaluation against gold conversion (right) Left: Most points lie below the diagonal, indicating that the quality of converted ... coverage of english grammars In Proceedings of the workshop on Speech and Natural Language, pages 306–311 Michael Auli and Adam Lopez 2011 A comparison of loopy belief propagation and dual decomposition...
  • 5
  • 492
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Confined conversion of CuS nanowires to CuO nanotubes by annealing-induced diffusion in nanochannels" ppt

Hóa học - Dầu khí

... Ni-filtered Cu Ka radiation (l = 1.5418 Å) Identical slit width and accelerating voltage were used for all the samples CuS nanowires and CuO nanotubes were observed on a field emission scanning electron ... single crystal nature of the CuS nanowire The HRTEM image of CuS nanowire (Figure 3b) with clearly visible lattice fringes also provides the evidence of single-crystal nature A typical TEM image ... Eerny R, Valvoda V: “Relation between Crystallographic Microstructure and Electrochemical Properties of CuO for Lithium Cells” ElectrochimActa 1990, 35:245 Cheng CL, Ma YR, Chou MH, Huang CY, Yeh...
  • 6
  • 285
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Growth and survival in Quercus ilex L. seedlings after irrigation and artificial shading on Mediterranean set-aside agricultural land" docx

Báo cáo khoa học

... set-aside agricultural land in Mediterranean areas using sclerophyllous oak Quercus ilex L seedlings This tree dominates a large part of the natural forests and woodlands in western European and African ... seedling survival, assessed once per season and year (12 survival counts in total); 2) seedling growth, measured yearly as: i) seedling height; ii) stem diameter (2 cm above ground level); and ... [11]Kessler J.J., Laban P., Planning strategies and funding modalities for land rehabilitation, Land Degrad Rehabil (1994) 25-32 Lansac A.R., Zaballos J.P., Martin A., Seasonal water potential changes...
  • 7
  • 253
  • 0
Ecological aspects of the floral phenology of the cork-oak (Q suber L): why do annual and biennial biotypes appear docx

Ecological aspects of the floral phenology of the cork-oak (Q suber L): why do annual and biennial biotypes appear docx

Báo cáo khoa học

... Original article Ecological aspects of the floral phenology of the cork-oak (Q suber L) : why annual and biennial biotypes appear? JA Elena-Rossello JM de Rio JL Garcia Valdecantos * IG Santamaria ... strategies / annual and bien- Résumé — Phénologie florale du chêne-liège (Quercus suber L) : aspects écologiques des biotypes annuel et biannuel Les observations phénologiques (époque de floraison ... afforestation strategies, grafting, viability of seed orchards and propagation techniques in general Meteorological were spectively (fig 1) opment of the male and female flowers and of the acorns...
  • 9
  • 131
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Growth response of holm oak (Quercus ilex L) to commercial thinning in the Montseny mountains" doc

Báo cáo khoa học

... as related to light and nutrient regimes, on stand regeneration by sprouts and seedlings, and on wildlife habitats should be known for a proper use of this silvicultural practice ACKNOWLEDGMENTS ... ACKNOWLEDGMENTS Collaboration in fieldwork from many colleagues and students is gratefully acknowledged This work was partly funded by a grant from the Caixa d’Estalvis de Barcelona and by CICYT project ... this range The regression was: dbh are likely to change as a result of thinning Conversely, for stem biomass the slow rates of growth displayed by holm oak makes unlikely that allometric relations...
  • 10
  • 185
  • 0
báo cáo khoa học:

báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx

Báo cáo khoa học

... region” (5’TTGTAAAACGACGGCCAGTGAATTGTAATACG ACTCACTATAGGGCGAATTGGGTACCGGG CCCCCCCTCGAGGTATAAGCTTGATATCGAAT TCCGTTGCTGTCG-3’), “2variant39” (5’-GCTTGA TATCGAATTCCGTTGCTAATTCCGTTGCTGTCG3’), “3variant51” ... mask TGCGA-tagged/NotI/vector regions 3’ to the inserted EST, “pB SK- at NotI site” (5’-TGCGAGCGGCCG CCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTT TAGTGAGGGTTAATTTCGA GCTTGGCGTAATCATGGTCATAGCTGTTTCC-3’) and ... (5’-GATCAGCGGCCGCCACCGCGG TGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGG GTTAATTTCGA GCTTGGCGTAATCATGGTCATAGCTGTTTCC-3’) sequences were added to the vector screen file A set of Perl programs was designed to...
  • 23
  • 403
  • 0
báo cáo khoa học:

báo cáo khoa học: " Proteome analysis of Norway maple (Acer platanoides L.) seeds dormancy breaking and germination: influence of abscisic and gibberellic acids" ppsx

Báo cáo khoa học

... establishment GAs can also play a role in controlling the abundance of β-glucosidase, which might be involved in cell wall loosening in the embryo, needed for cell elongation and radicle extension ... assembly and subcellular targeting and controls the activity of enzymes, regulatory proteins and peptides Proteases are thus involved in all aspects of the plant life cycle ranging from the mobilisation ... central regulator of plant seed development and ABA signalling ABI3 determines ABA sensitivity and plays a central role in establishing desiccation tolerance and dormancy during zygotic embryogenesis...
  • 13
  • 255
  • 0
báo cáo khoa học:

báo cáo khoa học: " Origins of the amphiploid species Brassica napus L. investigated by chloroplast and nuclear molecular markers" pps

Báo cáo khoa học

... understanding of the mechanisms and genetic factors controlling the creation of stable amphiploids, and this will facilitate the incorporation of novel alleles from the wider Brassica genepool Conclusions ... Italy, and a similar crop is also grown in Portugal In both of these areas, it is highly likely that brocoletto would have been cultivated alongside B oleracea crops such as kales, cabbages and ... Appl Genet 2006, 113:1221-31 Allender CJ, Allainguillaume J, Lynn J, King GJ: SSRs reveal uneven distribution of genetic diversity in chloroplast genomes of Brassica oleracea L and (n = 9) wild...
  • 9
  • 414
  • 0
P L U G - I NT4Decision Making Using ExcelLEARNING OUTCOMES1. Describe the use of the IF pptx

P L U G - I NT4Decision Making Using ExcelLEARNING OUTCOMES1. Describe the use of the IF pptx

Tin học văn phòng

... two or more cells to a constant = Equal to < Less than > Greater than ≤ Less than or equal to ≥ Greater than or equal to ≠ Not equal to NOT Logical Not AND Logical And OR Logical Or To use the IF ... value of the cell containing the Sales Dollar amount The Goal Seek values read “Set cell = B3, To value = 2500, By changing cell = $B$1.” To use the Goal Seek command: Select Tools from the main ... standard Excel package, but it has to be installed To install Solver, the following: Select Tools from the main menu, then select Add-Ins After clicking Add-Ins, scroll down to Solver Add-in and...
  • 14
  • 539
  • 0

Xem thêm