concepts requirements and contents of stages involved in a business strategy formulation process
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC forward, CCCACGTGTTGAGATCATTG reverse, GAGGAACAGCAGAGAGCCTC forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA forward, GCTCCGCCACTATTGCTATT ... GCTCCGCCACTATTGCTATT reverse, AGGTGCAGCAGCTTCAGTTT forward, CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA forward, GAGCAGGTCCAGGAACATTG reverse, ... TTGCTCTCGTTCCAAAAGGA forward, AAGGAAGGCTGGAAAAGAGC reverse, TACAGCTTCACCACCACAGC forward, TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC forward,...
- 12
- 560
- 0
Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis
... dominance of a gram-negative bacterial group, appearing as cocci in a form of clusters or tetrad formation in a laboratory scale activated sludge reactor operated under alternating anaerobic and ... of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb BAC library of Kineosphaera limosa strain ... although genes involved in PHA metabolism possess similar features, the structure and organization are diverse a) phaC phaA phaC phaB phaA phaB b) c) d) phaC1 phaC phaZ phaC2 phaE phaA phaD phaB Figure...
- 116
- 492
- 0
ConstructionandCharacterizationofaFulllengthcDNALibraryandIdentificationof GenesInvolvedinSalinityStressinWild Eggplant(SolanumtorvumSwartz)
... Ishikawa, S Baba, T Takabe, K Wada, T Ishii, and T Takabe 2001 Molecular cloning and functional characterization of two kinds of betaine-aldehyde dehydrogenase in betaine-accumulating mangrove Avicennia ... engineering of the ornithine synthesis pathway by the overexpression of a tomato N-acetyl-L-glutamate synthase gene (SlNAGS1) in Arabidopsis thaliana induced an increase in the ornithine levels and ... genes that contained the initiation codon (ATG) of the open reading frame (ORF) were functionally assigned as proteins involved in salinity stress, including: betaine aldehyde dehydrogenase (BADH2)...
- 10
- 387
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew Kachites McCallum 2002 Mallet: A machine learning for language ... German grammar (Fagan, 2009) Compound-cutting Nominal and adjectival compounding is common in German, and loanword compounds are commonly found in MZEE: (1) a chart|tauglich (suitable for the charts) ... mixed-lingual data with an application to parsing Ph.D thesis, Institute for Communicating and Collaborative Systems, School of Informatics, University of Edinburgh Eduardo G Altmann, Janet B...
- 5
- 537
- 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... consisting of rifampicin, isoniazid and pyrazinamide The duration of treatment usually lasts 6-8 months [(n=36; 95%) (Table 5)] Table Physicians’ approach in the diagnosis of PTB Yes CXR alone ... patients The unavailability of ready forms in the offices of our private practitioners, the lack of information on the health authority to contact and not just the paperwork that it entails may ... Manalo MFC, Pineda AV, Montoya JC Knowledge, attitudes and practices for tuberculosis among Filipino Family Physicians: a comparative analysis by practice setting and location Phil J Microbiol Infect...
- 10
- 517
- 1
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx
... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural area of Nepal Int J Tuberc Lung Dis, ... of the diagnosis intervals and initiation of treatment intervals with respect to days One hundred and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation ... Table gives a sub-analysis of application interval and patient delays with respect to several factors Age, sex, area of residence, and education level had no effect on the application interval...
- 6
- 466
- 0
Báo cáo hóa học: "Evaluation, diagnosis, and treatment of lead poisoning in a patient with occupational lead exposure: a case presentation" pptx
... smoked in the working place, which was having poor housekeeping practices and minimum engineering control, lacking local and general exhaust ventilation and washing facilities culminating into alarmingly ... synthesis and elevated levels of the precursor δ-aminolevulinic acid (ALA), which is a weak gamma-aminobutyric acid (GABA) agonist that decreases GABA release by presynaptic inhibition [6,7] Lead is ... clothes and no separate areas were provided for the removal and storage of the lead-contaminated protective work clothing and equipment The regulatory body should make it mandatory to evaluate and...
- 4
- 542
- 0
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
... aggressive malignant lymphomas to characterise metabolically undetermined masses, tumour staging and restaging, treatment response evaluation and radiotherapy treatment planning In fact, it allows ... allows a combination of both anatomical and biological co-registered images acquired in the same session, with a dual gain in diagnostic accuracy Staging is crucial in the identification of the appropriate ... competing interests EP is the senior author and was involved in collecting patient details, reviewing the literature and final proofreading of the manuscript AS was involved in collecting Figure...
- 4
- 360
- 0
Báo cáo khoa học: "Copper deficiency and effects of copper supplementation in a herd of red deer (Cervus elaphus)" ppt
... Acta Veterinaria Scandinavica 2008, 50:8 http://www.actavetscand.com/content/50/1/8 yearlings The animals were kept in a 20 hectare enclosure consisting of permanent grazing land and deciduous ... routinely for histological examination Standard bacteriological examination on calf blood agar plates was performed on samples of lung, liver and intestinal content Additionally, specific bacteriological ... level in January 2000 The reproductive success also improved remarkably, with 90% of hinds scanned in January 2002 and 2003 being pregnant Faecal parasitological examinations of the animals in the...
- 4
- 255
- 0
Báo cáo sinh học: " Identification of chromosomes involved in a Robertsonian translocation in cattle" ppt
... help of Mr G Fabre and his technical staff in the housing and handling of the animals at the Domaine Experimental de Carmaux (INRA) is gratefully acknowledged REFERENCES Berland H.M., Sharma A. , ... chromosomes involved in the translocation banding methods were identified using the G, C and R MATERIALS AND METHODS Animals A total of 16 cows were inseminated with frozen semen from F , d’Aquitaine A. I ... unbalanced gametes Those rearrangements are not easily eliminated by selective breeding and can be spread rapidly through the use of artificial insemination For example, in cattle, the 1/29 translo-...
- 6
- 227
- 0
crowder - post modern investment; facts and fallacies of growing wealth in a multi-asset world (2013)
... Investments: A Road Map Return and Risk Attributes and Strategy Allocation The Myth of Average: Asset Allocation in Extreme Markets Alternative Asset Allocation Approaches A Personal View: Issues in Asset ... market in ideas, such that any ‘‘new’’ approach to investment management or asset allocation offering new advances often reflects marketing advances more than an asset-management advance After all of ... products, it remains a constant within traditional asset classes as well THE CORE CONCEPTS IN MANAGING WEALTH At its core, risk management and asset allocation require asset managers and their investors...
- 338
- 533
- 0
Dynamics and characterisation of membrane fouling in a long reverse osmosis membrane channel
... applications; food and beverage processing combined with pharmaceuticals and medical applications account for another 40% of sales; and the use of membranes in chemical and industrial gas production ... AWWA 1999; Bremere et al 2001) make RO an attractive process in water treatment and reclamation In addition, RO has many advantages over conventional separation processes such as distillation and ... translated into an increase in profit and a lower cost associated with a smaller downstream treatment train Higher recovery is usually achieved by increasing the membrane surface area, which includes...
- 180
- 343
- 0
HLA g and KIR2DL4 alleles haplotypes and risk of pre eclampsia in a malay population
... GCA GCA GCA GCA CTA CTA CTA A CTA CAT CCA CCC TTC HLA G *0108 HLA G *0109 HLA G *0110 ATG HLA G *0111 ATG ATC ATC ATC ATC CCA CCA CCA CCA CAT CAT CCA CAT CCA CAT CCA AGG AGG CAT CCA *TG ATG ATC ... Southeast Asian Chinese (CH), Indian (IN) , and Malay (ML) populations 51 viii Table 16 Analysis of maternal and fetal KIR2DL4 allele frequencies in cases and controls 55 Table 17 Analysis of maternal ... GCC CTG GAG TAC CAC CAC GCA ACG CCG GGC GGT AGA AGG TCC ACG CGG GCG CAG CCG GCC CAC GGA CTC CCA CAT CCA GGT GCT GGT CAT CCA CCA 926 AGG CAT GGT GAA GCG GCT CCA CCA CCA CGA CAT CAT CAT CAT CGG GCC...
- 103
- 278
- 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GGAGCATCAGTTTGACAGCA-3’; ANK3 reverse 5’-TTCCACCTTCAGGACCAATC-3’; STAU2 forward 5'-CCGTGAGGGATACAGCAGTT-3'; ... Carloni V, Mazzocca A, Pantaleo P, et al The integrin, alpha6beta1, is necessary for the matrix-dependent activation of FAK and MAP kinase and the migration of human hepatocarcinoma cells Hepatology ... and activation of cytokines and chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol-induced mucosal injury in the upper gastrointestinal tract leading to increase...
- 8
- 702
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGACACTCATACTAACGCCATG GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGCCGGCTGGACTTGTCCGG GGAGCCACCATTAAAGAAGGG ... GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC ... TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA...
- 15
- 597
- 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
... b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ATTTCCTGTTG-30 ... Kirakosyan, A. , Inoue, K., Hiraoka, N., Ikeshiro, Y., Kushiro, T., Shibuya, M & Ebizuka, Y (2001) Cloning and characterization of a cDNA encoding b-amyrin synthase involved in glycyrrhizin and ... Pfu DNA polymerase (Stratagene) used as the DNA polymerase Two primers of 50 -CTGGTACCGATTGAGTTGAGGTG ATTG-30 (Kpn I site underlined) and 50 -CCTCTAGAGTA AAAGTCTCCAATC-30 (Xba I site underlined)...
- 7
- 491
- 1
Báo cáo sinh học: " Regulators of kinesin involved in polarized trafficking and axon outgrowth" potx
... [17,18]) and axonal proteins (such as growth associated protein 43 (GAP-43) and presynaptic Cargoassociated protein Cargo vesicle Adaptor protein Kinesin light chain Kinesin heavy chain Microtubules ... insights into both the molecular mechanisms and the complexity of axonal trafficking The kinesins are a large family of microtubule-associated motor proteins that have crucial roles in intracellular ... kinesin-1 specifically accumulates at the tip of neurites that are fated to become axons, and the initiation of an axon extension stabilizes the axonal localization of kinesin-1 [16] Second, during...
- 4
- 331
- 0
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTCCTAAAACACCATG, AAATTATGGGTTTTAAGGGCTAGAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) ... gDNA The primer sequences (shown in 5'-3' orientation) are CTTTCAAGCCCAATACCCAAAGGCACTG and GGGAATGGCAATCACTGCATTGGTATAG for CYP720B4; and GGAGAATTAGTGAGTCATGTCGATG and CTCTGTCTGATTGGTGGAACAGGC ... contain a TCA-element at positions -815 and -3,291 in PGB02 and at positions 1,227, -676 and -1,162 (TCAGAAGAGG, GAGAAGAATA and CAGAAAAGGA) in PGB04, respectively This element was first characterised...
- 13
- 329
- 0
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot
... 5'-AAC TTT TGG GTG TGG CTC TG-3' (r); Itgae, 5'-TGG CTC TCA ATT ATC CCA GAA3' (f), 5'-CAT GAC CAG GAC AGA AGC AA-3' (r); Adamts2, 5'-AGT GGG CCC TGA AGA AGT G-3' (f), 5'CAG AAG GCT CGG TGT ACC AT-3' ... beta-actin, 5'-ACC CTA AGG CCA ACC GTG A- 3' (f), 5'CAG AGG CATA CAG GGA CAG CA-3' (r); GapDH, 5'TGG TGA AGG TCG GTG TGA AC-3' (f), 5'-TGA ATT TGC CGT GAG TGG AG-3' (r) Data analysis and statistics ... 5'-GTC CGC TAC AAA GGG GAG AT-3' (f), 5'-TAG CCA GTC CAG TCC GAG TC-3' (r); Itgb7, 5'-GAG GAC TCC AGC AAT GTG GT-3' (f), 5'-GGG AGT GGA GAG TGC TCA AG-3' (r); Itga4, 5'-TTC GGA AAA ATG GAA AGT GG-3'...
- 16
- 320
- 0
Báo cáo y học: " Mitogen-activated protein kinases and NFκB are involved in SP-A-enhanced responses of macrophages to " pdf
... members of the STAT pathway, PI3K/Akt pathway and mitogen-activated protein (MAP) kinase family [10-12] MAP kinases are a family of serine/threonine kinases that are activated by phosphorylation of ... SP-ABCG infection of rat macrophages (data not shown) There is a growing body of evidence that survival of intramacrophage pathogens is linked to activation and deactivation of intracellular kinases ... these pathways are activated by BCG alone and that opsonization of BCG with SP -A leads to enhanced activation of both pathways, contributing to increased intracellular BCG killing Materials and...
- 11
- 435
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose