Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN NATIONAL UNIVERSITY OF SINGAPORE 2005 CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN (M. Sci. NANKAI UNIVERSITY, CHINA) A THESIS SUBMITTED FOR DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF CIVIL ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2005 DEDICATION Dedication to my father, Ji Lieshun, mother Li XueQin and my son Liu SiBo, sisters Ji ZhiPing, Ji ZhiJing, and my deceased husband Liu ZhiSheng. Without their love, understanding and constant support through all these years, I would never have finished this work. 谨以此献给我最亲爱的父亲纪烈顺，母亲李学琴，儿子刘思博, 姐姐纪志萍，妹妹 纪志敬, 以及已故丈夫刘志生。 i ACKNOWLEDGEMENTS I am indebted to my supervisors, Associate Professor Liu Wen-Tso and Professor Ong Say Leong, for their meaningful advice, constructive suggestions and supervision in all aspects of my graduate career, and, moreover, for their kind support in my personal life during the past few years at the National University of Singapore. Also, special thanks are extended to Dr. Yin Zhongchao, Tian Dongsheng, Wang Dongjiang, Yang Fan, Gu Keyu and Wu Lifang from the Temasek Life Science Laboratory for generously providing the research facilities, as well as many illuminating discussions on my research work. Further appreciation is given to all the colleagues in our laboratory, Ms. Tan Fea Mein, Emily Li Sze Ying, Chen Chia-Lung, Pang Chee Meng, Wong Man Tak, Koh Lee Chew, Pei Ying and Hui Ling for their help, advice and support. Lastly, sincere gratitude is extended to all my friends, Sim Chiangkhi, Chiang Hwa, Benny, Sofen, Sam He, Professor Zhang Jinchang, Dr. Zhang Guojun, James Burg, David Kenneth Stone; all of whom, in one way or another, have rendered their assistance in helping me to overcome all the difficulties inherent in producing this work. Thank you. ii TABLE OF CONTENTS Dedication………………………………………………………... Page No. i Acknowledgements……………………………………………… ii Table of Contents………………………………………………... iii Summary………………………………………………………... vi Nomenclature……………………………………………………. vii List of Figures……………………………………………………. x List of Tables…………………………………………………….. xii Introduction ……………………………………………... 1 1.1 Background ………………………………………………… 1 1.2 Problems statements………………………………………… 6 1.3 Objective………………………………………………….….. 9 Chapter 1 Chapter 2 Literature review………………………………………… 11 2.1 Phosphorus removal and the EBPR process………………… 11 2.1.1 EBPR………………………………………………… 11 2.1.2 Bacterial groups involved in EBPR systems: PAO and GAO………………………………………………. 12 2. 2 Biological aspects of PHA…………………………………. 15 2.2.1 PHA synthase…………………………………………. 16 2.2.2 Primary structure of PHA synthase…………………… 16 2.2.3 Genes encoding enzymes involving in PHA synthesis.. 19 2.2.4 Organization of PHA biosynthesis genes…………….. 20 2.3 Biological aspects of glycogen………………………………. 21 2.3.1 The nature of glycogen………………………………... 22 iii 2.3.2 Enzymes involved in glycogen metabolism………….. 23 2.3.3 Genes encoding enzymes involving in glycogen biosynthesis…………………………………………. 25 2.4 Polyphosphate……………………………………………….. 27 2.4.1 The nature of polyP…………………………………… 27 2.4.2 Biosynthesis of polyP………………………………… 29 2. 5 Cloning of PHA biosynthesis genes...……………………….. 32 Chapter 3 Materials and Methodology………………………………... 36 3.1 Materials…………………………………………………….. 36 3.1.1 Main equipments…………………………………….. 36 3.1.2 Main supplies used in this study…………………….. 38 3.1.3 Bacterial strains, plasmid and media………………… 38 3.1.4 Primers, enzymes, DNA markers and chemicals used... 41 3.2 Methods……………………………………………………… 44 3.2.1 BAC library construction……………………………… 44 3.2.1.1 DNA manipulation…………………………….…. 44 3.2.1.1.1 Preparation of high-molecular-weight DNA, DNA plugs and plasmid DNA………………. 44 3.2.1.1.2 Recovery of partially digested DNA Electroelution………………………………... 45 3.2.1.1.3 Recovery of DNA from agarose gel…………. 45 3.2.1.2 Partially Restriction Enzyme Digestion…………... 46 3.2.1.3 Ligation of DNA fragments to plasmid vector…… 46 3.2.1.4 Electroporation and heat shock transformation… 47 3.2.1.5 Construction and replication of BAC library……... 48 3.1.2.6 Characterization of BAC library………………….. 48 3.2.2 Screening and evaluation of BAC library…………….. 49 3.2.2.1 Probe preparation by PCR amplification………... 49 3.2.2.2 Transfer and cultivation of BAC clones on nylon membrane……………………………………... iv 51 3.2.2.3 BAC library screening by Southern Hybridization and autoradiograph………………………………. 51 3.2.2.4 Cloning, hybridization and sequencing of targeted DNA fragments……………………….………….. 52 Chapter 4 Results…. …………………………………………………… 53 4.1 BAC library construction from Lpha5T………………………. 53 4.2 Screening of Lpha5T BAC library for phaC gene…………….. 57 4.3 Sequencing and Annotation of the fragment cloned………….. 61 Chapter 5 Discussion…………………………………………………… 76 5.1 Construction of BAC library………………………………….. 76 5.2 Preparation of probe…………………………………………... 79 5.3 Sequence analysis…………………………………………….. 80 5.4 Gene annotation………………………………………………. 81 Chapter 6 Conclusion and Recommendation ………………………… 84 6.1 Conclusion……………………………………………………. 84 6. 2 Recommendation .…………………………………………. 86 References………………………………………………………………... v 88 Summary Bacterial artificial chromosome (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11. Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb. BAC library of Kineosphaera limosa strain Lpha5T was screened with a probe specific for phaC gene which was amplified using PCR from Alcaligenus latus, a phaC positive bacterial strain. Southern blot screening of 6144 BAC clones with PCR amplified chromosome marker allowed the identification of 18 BACs hybridizing with the probe. A fragment, which was hybridized with the probe was cloned and sequenced. The sequence in total contains 2186 bases. The distribution of ACGT along the strand was A: 14.18% (310 nt), T: 16.24% (355 nt), G: 41.03% (897 nt) and C: 28.45 % (622), resulting in a GC content of 69.48%. Further analysis revealed five open reading frames (ORFs) within the fragment. The number of nucleotides contained in each ORF was 84, 138, 507, 321 and 265 bp, encoding peptides with length of 27, 45, 168, 106 and 88 amino acids, respectively. The peptides shared some similarities with known genes. ORF5 encodes a peptide without end in this particular fragment. It suggested a longer ORF with unknown function. Keywords: Kineosphaera limosa strain Lpha5T, BAC library, PCR Probe, Southern Hybridization, Screening, ORF vi NOMENCLATURE A adenine ADP-Glc PPase ADP-glucose pyrophosphorylase BAC Bacterial Artificial Chromosome BSA bovine serum albumin bp base pair C cytosine CO2 carbon dioxide CoA coenzyme A CIP calf intestinal alkaline phosphatase CM chloramphenicol DGGE denaturing gel gradient electrophoresis DMSO dimethyl sulfoxide DNA deoxyribonucleic acid EBPR enhanced biological phosphorus removal E.coli Escherichia coli EDTA ethylenediaminetetraacetic acid RFLP restriction fragment length polymorphism FISH fluorescence in-situ hybridization G guanine GAO glycogen accumulating non-poly-P organisms GC gas chromatography glgA glycogen synthase gene vii glgB branching enzyme gene glgC ADP-glucose pyrophosphorylase gene glgX glycogen debranching enzyme gene glgP glycogen phosphorylase gene HA hydroxyalkanoic acid HACoA hydroxyalkanoic acids HB hydroxybutyric HDD hydroxydecanoate 3HHx 3-hydroxyhexanioc acid HHp hydroxyheptanoate 3HO 3-hydroxyoctamoic acid IPTG isopropylthiogalactoside MCL medium-chain-length mRNA messenger RNA Mw molecular weight NADH reduced form of nicotinamide adenine dinucleotide. NADPH reduced form of nicotinamide adenine dinucleotide phosphate NMR nuclear magnetic resonance N nitrogen ORF open reading frame P phosphorus PAO polyphosphate accumulating organism PCR polymerase chain reaction viii PFGE pulse field gel electrophoresis PHA polyhydroxyalkanoate PHB polybetahydroxybutyrate, the simplest form of PHA phaA ketothiolase gene phaB NADP-dependent acetoacetyl-CoA reductase gene phaC PHA synthase gene PhaP phasings PhaZ PHA depolymerase PMSF phenylmethylsulfonyl fluoride polyP polyphosphate ppk polyP kinase gene ppx exopolyphosphateses gene RNA ribonucleic acid 16SrRNA small subunit ribosomal ribonucleic acid SCL short-chain-length (SCL) SDS sodium dodecyl sulfate T thymine Taq DNA polymerase Thermus aquaticus DNA polymerase Tris tris(hydroxymethyl)aminomethane X-GAL 5-bromo-4-chloro-3-indolyl-beta-D-galactoside YACs yeast artificial chromosomes VFA volatile fatty acid ix LIST OF FIGURES Figure Page No. Figure1.1 Typical profiles of substrate metabolism observed in EBPR bioreactor (Mino et al., 1987) 2 Figure 2.1 A tree showing the phylogenetic relationships among the putative PAO and GAO. (Seviour, et al. 2003) 14 Figure 2.2 Molecular formulae of PHA units: (a) hydroxybutyrate; (b) hydroxyvalerate; (c) hydroxymethylbutyrate; (d) hydroxymethylvalerate (Lee and Choi, 1999) 15 Figure 2.3 Classification of PHA synthases based on their primary structures and substrate specificities 17 Figure 2.4 Molecular organization of PHA synthase genes involved in PHA metabolism. 21 Figure 2.5 Molecular formula of glycogen (Voet and Voet, 1995) 22 Figure 2.6 Comparison of the known bacterial glg operons. Schematic alignment of glg structural genes 27 Figure 2.7 Inorganic polyphosphate. 28 Figure 2.8 Comparisons of polyphosphate kinase (PPK) sequences among 15 microorganisms. 31 Figure 4.1 Lpha5T genome DNA total digestion by HindIII and BamHI 53 Figure 4.2 Lpha5T Transformants on X/I/C LB plate 55 Figure 4.3 BamHI digestion patterns of randomly selected BACs from Lpha5T BAC library 56 Figure 4.4 Distribution of the insert sizes from 300 randomly selected recombinant BACs digested with Bam HI 56 Figure 4.5 HindIII digestion of plasmid from Lpha5T BACs 57 x Figure 4.6 Dot blot showing positive clones hybridized with probe for phaC gene 58 Figure 4.7 Total digestion of plasmid from positive clones hybridized with probe for phaC gene 59 Figure 4.8 Membrane hybridization showing a positive 2.5 kb fragment 59 Figure 4.9 BamHI digestion of the constructed plasmid before Southern hybidization 60 Figure 4.10 Image after hybridization with DIG labeled probe 61 Figure 4.11 Nucleotide sequence of the 2,186 bp fragment, along with the deduced amino acid sequence of the five ORFs found within the fragment. 64 Figure 4.12 Restriction map of ORF 1 67 Figure 4.13 Restriction map of ORF 2 68 Figure 4.14 Restriction map of ORF 3 68 Figure 4.15 Restriction map of ORF 4 69 Figure 4.16 Restriction map of ORF 5 69 xi LIST OF TABLES Table Page No. 20 Table 2.1 Genes involved in PHA biosynthesis Table 2.2 Enzymes involved in glycogen metabolism 23 Table 2.3 Relationships between carbon metabolism and regulatory and structural properties of ADP-Glc PPase from different organisms 24 Table 2.4 Genes encoding enzymes involved in glycogen metabolism 26 Table 2.5 Strategies for cloning of PHA synthase genes 34 Table 2.6 Applications using the BAC library as a tool. 35 Table 3.1 Key equipments necessary for this study 37 Table 3.2 Main supplies used in this study 38 Table 3.3 Bacterial strains and plasmid used in this study 40 Table 3.4 Prescription for R2A medium. 41 Table 3.5 Primers used in this study 42 Table 3.6 Enzymes and DNA markers used in this study 43 Table 4.1 Restriction Enzyme digestion characteristics of Lpha5T genomic DNA 54 Table 4.2 Features of the six Open Reading Frames within the sequence cloned 66 Table 4.3 Summary of the first two Blast Hits of each ORF 71 xii Chapter 1 Chapter 1 Introduction 1.1 Background Eutrophication is an environmental pollution phenomenon when nutrients like nitrogen (N) and phosphorus (P) are present at levels exceeding growth-limiting concentrations for photosynthetic organisms in aquatic environments (Conley, 2000). As a consequence, an increase in photoplankton occurs and this further leads to an increase in water turbidity, decreases in light penetration and an increase in photosynthetic oxygen generating activity. At the same time, the growth of aerobic bacteria, plants and animals can eventually deplete oxygen in the hypolimnion, leading to death in fish and plants. Finally, the consumption of eutrophic water can pose a serious health threat since some of the cyanobacteria can release toxins, and the symptoms caused after exposure to these toxins can be, in some cases, fatal. To prevent the occurrence of eutrophication in natural water bodies, the input of nutrients like P should be significantly reduced through chemical or biological methods. The chemical process for P removal is achieved by addition of salts containing cations, such as calcium, iron, or aluminium to form insoluble Pi precipitates in the wastewater treatment processes. The precipitates are removed at different stages based on the adding point of salts. However, the cost of chemical treatment is high, and the amount of daily wasted sludge is also largely increased. 1 Chapter 1 From the cost perspective, biological P removal methods or enhanced biological phosphorus removal (EBPR) processes have become a promising alternative. EBPR processes are achieved by encouraging the accumulation of P in bacterial cells in the form of polyphosphate (polyP) granules in excess of the levels normally required to satisfy the metabolic demands of cell growth. Subsquently, the P-accumulating microorganisms are separated from the supernatant in a settling tank, where the P-free supernatant is discharged into receiving water bodies, and the P-accumulating microorganisms are either returned to the process or disposed as waste. An EBPR process includes an anaerobic followed by an aerobic stage and a settling stage. Typical profiles of substrate metabolism observed in EBPR bioreactor are shown in Figure 1.1 (Mino et al., 1987). In the anaerobic stage, carbon substrates like acetate and propionate are taken up and stored as reserved materials such as polyhydroxyalkanoates (PHAs). This is accompanied by the degradation of internal polyP and glycogen and the release of Pi. In the subsequent aerobic stage, where no external carbon is present, stored PHAs are used as the carbon source, the glycogen reserve is recovered and polyP is synthesized from Pi. Figure1.1. Typical profiles of substrate metabolism observed in EBPR bioreactor (Mino et al., 1987) 2 Chapter 1 Polyphosphate accumulating organisms (PAO) and glycogen accumulating non-poly-P organisms (GAO) are two major functional bacterial groups involved in EBPR processes. PAO are a group of bacteria responsible for the EBPR activity. Typically, in the anaerobic phase, PAO rapidly assimilate organic substrate and store them in the form of PHAs by degrading polyP into Pi to generate energy for substrate uptake and storage. In the subsequent aerobic phase, PAO grow aerobically; take up and accumulate Pi as polyP, using stored PHAs as energy and carbon sources. GAO have the potential to directly compete with PAO in EBPR system since they can also take up volatile fatty acids (VFA) under anaerobic conditions and grow on the intracellular storage products aerobically. However, GAO cannot accumulate polyP. As a result of the proliferation of GAO, the EBPR activity is often deteriorated in EBPR processes (Seviour et al., 2000). However, the precise roles of GAO are still not verified. PHAs, glycogen and polyP are the three key biopolymers in the metabolism of PAO and GAO in the EBPR process. To understand the EBPR process and its performance, better understanding of the metabolic pathways on the metabolites involved are required. PHAs are a family of polyesters synthesized by microorganisms. In the EBPR system, PHAs are accumulated as the carbon source in the anaerobic phase and later used in the aerobic phase to accumulate energy for polyP accumulation, and for growth. So far, the accumulation and the metabolism of PHAs have been studied in detail with Pseudomonas spp. and Ralstonia spp. (Anderson & Dawes, 1990). However, PHA metabolism in bacteria involved in the EBPR processes is little understood, and suspected to be different 3 Chapter 1 from that observed from Pseudomonas spp. and Ralstonia spp.. For example, Acinetobactor spp., which was found in the anaerobic-aerobic activated sludge process, showed a different PHA accumulation pattern in pure culture and in situ studies (Auling et al., 1991). In known PHA-accumulating bacteria, PHAs are synthesized by PHA synthase with hydroxyalkanoic acids (HACoA) as monomers. The primary structures, biochemical features and the proposed catalytic mechanism of PHA synthases are different among bacteria such as Ralstonia eutropha, Alcaligenes latus, Rhodobacter capsulatus, and Thiocystis violacea (Rehm & Steinbuchel, 1999; Choi et al., 1998; Kranz, et al., 1997; Liebergesell et al., 1993a). It is known that PHA synthase is encoded by PHA synthase gene (phaC). In addition to the phaC gene, the key genes involved in the metabolism of PHA are the ketothiolase gene (phaA), the NADP dependent acetoacetyl-CoA reductase gene (phaB), and the PHA depolymerase gene (phaZ). These genes are often clustered together and organized differently in various bacterial genomes (Rehm & Steinbuchel, 1999). Although phaC gene has been studied in detail in many bacteria, little is known about PHA synthases and the PHA synthase genes in the EBPR system. Thus, more research efforts are needed to improve our understanding on PHA metabolism in the EBPR process. Glycogen is another important intracellular polymer in EBPR process. It plays a role as carbon storage in both PAO and GAO. Glycogen is known to be synthesized from glucose-1-phosphate through several enzymes, such as ADP-glucose pyrophosphorylase 4 Chapter 1 (ADP-Glc PPase), glycogen synthase, glycogen branching enzyme, glycogen phosphorolase, and glycogen debranching enzyme; among these enzymes, ADP-Glc PPase, glycogen synthase and branching enzyme are key. These three enzymes are encoded by genes glgC, glgA, and glgB, respectively. So far, the enzymes and genes encoding these enzymes have been studied in a range of bacteria. Glycogen biosynthetic genes were first cloned in E. coli (Okita et al., 1981). Later on, glgA, glgB, glgC and glgP gene clusters were cloned in a number of bacteria, such as Agrobacterium tumefaciens (Uttaro & Ugalde, 1994), Bacillus stearothermophilus (Takata et al., 1997), and Rhodobacter sphaeroides (Meyer et al., 1999). These studies show that the genes responsible for glycogen biosynthesis are clustered together in one operon, but the organization of these genes varies among different bacteria. Although glg gene operon has been studied in detail in many bacteria, little is known about its involvement in the EBPR system. Lastly, the polyP metabolism in PAOs is an important mechanism in removing Pi from wastewater. PolyP is a group of polyanionic polymers consisting of orthophosphate. PolyP is present in numerous bacterial and archaeal cells, and also, in plant and animal tissues. The wide distribution of polyP suggests that this polymer is essential for cell function (Kornberg, 1995; Wood & Clark, 1988), but little is known about its biochemistry, especially in the EBPR biomass (Keasling et al., 2000). PolyP biosynthesis in model bacteria like E. coli, Neisseria meningitides and Acinetobacter spp. has been studied extensively (Kornberg et al., 1999). In most of these 5 Chapter 1 organisms, ADP phosphotransferase (polyP kinase, PPK) is thought to be the enzyme primarily responsible for polyP biosynthesis. PPK catalyzes the transfer of the terminal phosphate of ATP to a growing chain of polyP. This enzyme has been purified from E. coli (Ahn & Kornberg, 1990), and the gene encoding the enzyme, ppk, has been cloned and expressed in E. coli (Akiyama et al., 1992). Similar genes have been cloned from a number of bacteria (Zago et al., 1999; McMahon et al., 2002). However, little information of the ppk gene in organisms involved in EBPR is available. 1.2 Problem Statements In the EBPR processes, the involvement of PHA, glycogen and polyP have been well documented. However, the genetic information of the genes including the PHA sythase gene (phaC), glycogen biosynthesis genes (glgA and glgC), and the polyP kinase gene (ppk) involved in the metabolism of these biopolymers is yet to be understood. Moreover, little is known about the environmental conditions that lead to the synthesis and degradation of these genes. To improve the performance of EBPR, further studies on these genes are needed to better understand what environmental conditions may affect their metabolism, and, similarly, to manipulate polyP metabolism through genetic and metabolic engineering. At this moment, the study on the metabolism of the EBPR process still requires the isolation of pure cultures in order to provide substantial information on the microbiological, and biochemical, aspects of the EBPR processes. The first bacterial 6 Chapter 1 isolate from an EBPR process with a high P removal capacity was identified to be Acinetobacter spp. in Gamma-Proteobacteria (Fuhs & Chen, 1975), and its biochemical pathway related to P metabolism was subsequently studied (Auling et al., 1991; Bark et al., 1992). However, the Acinetobacter spp. has been proved not to be responsible for EBPR activity, as it did not perform the key biochemical transformations observed in EBPR sludge (Jenkins & Tandoi, 1991; Wagner & Erhart, 1994), and represented < 10% of total bacteria in the EBPR processes (Wagner & Erhart, 1994). Another bacterial strain is a Gram-positive coccus, Microlunatus phosphovorus that accumulates polyP to a very high level, which partially confirms the metabolic model of EBPR in assimilating P aerobically and releasing it anaerobically. However, M. phosphovorus cannot assimilate acetate under anaerobic conditions, and is not a dominating population in EBPR systems (Nakamura et al., 1995, Kawaharasaki, et al., 1998; Lee, et al., 2002). Recently, Rhodocyclus-related bacteria are considered to be important PAO (Hesselmann et al., 1999; Daims et al., 1999). However, it has yet been isolated and proved in pure culture studies as PAO. Cech and Hartman (1990) first reported the presence of Gram-negative cocci in clusters and tetrad formation in an activated sludge laboratory scale reactor operated under alternating anaerobic and aerobic periods. So far, a number of GAO have been isolated. These bacteria included for example Kineosphaera limosa sp. nov (Lpha5T) from Grampositive, high G+C group (Liu et al., 2002), genus Amaricocus in Alpha-Proteobacteria (Maszenan et al., 1997), and Defluvicoccus vanus in Alpha-Proteobacteria (Maszenan et al. 2000). These GAO can compete with PAO for substrates under anaerobic conditions, 7 Chapter 1 and were found to be more dominant than PAO in a deteriorated EBPR system (Cech & Hartman, 1993; Liu et al., 1997b). An understanding into the metabolic pathway of these GAOs under alternating anaerobic/aerobic conditions is therefore important for the optimization and stability of the EBPR process. Therefore, metabolism of the biopolymers (PHA, glycogen and PolyP) involved, and the characterization of genes related to these biopolymers would be highly relevant. Although GAOs are always considered to be associated with deteriorated EBPR systems, the exact role of GAO in EBPR process is still not well understood. In this study, K. limosa Lpha5T was used as the model GAO for genetic analysis. Although isolating representative cultures from EBPR is essential for studying the metabolism of EBPR, a large fraction of the organisms existing in activated sludge processes has not been successfully isolated (Amann et al., 1995; Palleroni, 1997; Amann, 2000). As a result, culture-independent techniques have been applied to study EBPR processes. For example, the 16S rRNA gene clone library approach has been proven to be effective in identifying dominant micro-organisms in a microbial environment without the need for cultivation (Bond et al., 1995; Christensson et al., 1998). Fluorescence insitu hybridization (FISH) with oligonucleotide probes targeting the 16S rRNA has further been applied to evaluate the abundance and distribution of specific phylogenetic groups in EBPR (Harmsen et al., 1996). In addition, community fingerprinting methods like denaturing gel gradient electrophoresis (DGGE) technique (Brdjanovic et al., 1997) and the terminal restriction fragment length polymorphism (T-FRLP) (Liu et al., 1997a) have been applied to reveal the microbial community structure in EBPR processes. These 8 Chapter 1 studies indicated that the EBPR sludge was dominated by a few dominant bacterial populations. Still, these fingerprinting methods cannot provide information on the function of microbial communities and the functional genes involved in the EBPR metabolisms. Recently, the bacterial artificial chromosome (BAC) library has emerged as a powerful tool to investigate the total genetic information in both pure and mixed culture of bacteria. BAC library has been successfully used for the study of uncultured microorganisms in soil samples to maintain, express and analyze environmental DNA (Michelle & Rondon, 2000). Likewise, the BAC library can be a potential means to study functional genes in an EBPR system. Objective The overall objective of this research was to construct a BAC library for a bacterial strain isolated from an EBPR system, and based on the BAC constructed, to isolate and further investigate the genes involved in the metabolisms of PHA in EBPR systems. The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor. Lpha5T could accumulate significant amount of PHA without P accumulation (Liu et al., 2000; Liu et al., 2002), making it a putative GAO. Specific objectives included: (1) To construct the BAC library for bacterial strain Lpha5T genomic DNA, (2) To further evaluate the BAC libraries constructed, (3) To prepare the specific probe used to screen the Lpha5T BAC library for phaC gene 9 Chapter 1 from another phaC gene positive bacterial strain A. latus, (4) Screen the Lpha5T BAC library for phaC gene, and (5) To clone and characterize the phaC identified. 10 Chapter 2 Chapter 2 Literature Review 2.1. Phosphorus removal and the EBPR process P is considered to be a critical pollutant to cause eutrophication in water bodies. Dissolved P usually in the form of Pi can be effectively removed from the treated wastewater using chemicals or biological methods to reduce an effluent Pi concentration to less than 1 mg/l (US.EPA.1987). Because of the high cost of chemicals and the increasing need for P removal, biological P removal is a promising method. Among biological P removal methods, enhanced biological phosphorus removal (EBPR) is one of the more commonly used approaches. 2.1.1 EBPR The EBPR system was first designed more than 40 years ago (Srinath et al., 1959). It can remove not only organic pollutant but also Pi, a causative element of eutrophication. It is achieved by encouraging the accumulation of Pi in the form of polyP by a group of bacteria known as PAO. PAO can accumulate P content to at least 2-3 times higher than other nonpolyP accumulating bacteria. The EBPR process usually includes an anaerobic followed by an aerobic stage and a settling stage. Typical profiles of substrate metabolism observed in an EBPR bioreactor are shown in Figure 1.1 (Mino et al., 1987). The chemical profiles indicate that Pi 11 Chapter 2 concentration increases in the anaerobic zone, and decreases to a level less than the influent Pi concentration in the aerobic zone. At the same time, PHA levels increase in parallel with the assimilation of acetate in the anaerobic zone, and PHA levels in the biomass fall in the subsequent aerobic stage, whilst glycogen concentration decreases in the anaerobic zone and increases in the aerobic zone. 2.1.2 Bacterial groups involved in EBPR systems: PAO and GAO PAO are a group of bacteria responsible for the EBPR activity. Typically, in the anaerobic phase, PAO rapidly assimilate organic substrate and store them in the form of PHAs through the degradation of polyP and the release of Pi. In the subsequent aerobic phase, PAO take up Pi and synthesize it to polyP using stored PHAs as carbon and energy source (Marais, et al., 1982; Mino et al., 1987). Another bacterial group involed in EBPR system is GAO (Cech & Hartman, 1990). GAO are also known as “G-bacteria”. It is postulated that GAO can directly compete with PAO for carbon substrate in EBPR systems since they are able to take up volatile fatty acids (VFA) anaerobically and grow on the intracellular storage products aerobically. In the EBPR process, GAO cannot accumulate polyP. As a result, the EBPR process often could not be controlled successfully and a failure in P removal would occur (Seviour et al., 2000). However, the precise role of the GAO needs to be further verified. The first bacterial strain of PAO isolated from biomass with a high P removal capacity is identified as a member of the genus Acinetobacter in Gamma-Proteobacteria (Fuhs & 12 Chapter 2 Chen, 1975). Its P metabolism related to EBPR activity was extensively characterized (Auling et al., 1991; Bark et al., 1992). However, the Acinetobacter spp. have been proved not the responsible PAO observed in the EBPR processes, because they did not perform the key biochemical transformations observed in EBPR sludge; It was later observed that Acinetobacter spp. represented less than 10% of total bacterial cells present in EBPR processes (Wagner & Erhart, 1994). Another bacterial strain of PAO is a Gram-positive coccus known as Microlunatus phosphovorus. It accumulates polyP to a very high level (Nakamura et al., 1995), conforms partially to the Mino model (Mino et al., 1987) by assimilating P aerobically and releasing it anaerobically. However, M. phosphovorus cannot assimilate acetate anaerobically (Nakamura et al., 1995), and has never been observed in EBPR systems in high abundance. Using molecular approaches, Rhodocyclusrelated bacteria are considered to be important PAO (Hesselmann et al., 1999; Crocetti et al., 2000). However, no pure culture from this group has been isolated to validate its role in EBPR metabolism. For GAO, Cech and Hartman (1990) first reported the dominance of a gram-negative bacterial group, appearing as cocci in a form of clusters or tetrad formation in a laboratory scale activated sludge reactor operated under alternating anaerobic and aerobic periods. They named this group of bacteria as “G-bacteria”, which were later classified as GAO. Since then, a number of GAO-like bacteria have been isolated, such as Kineosphaera limosa sp. nov (Lpha5T), a high G+C gram-positive, bacteria (Liu et al., 2000; Liu et al., 2002), Amaricocus (Maszenan et al., 1997) and Defluvicoccus vanus in the AlphaProteobacteria (Maszenan et al., 2000). These GAO are considered to be detrimental to the 13 Chapter 2 EBPR process as they compete for substrates anaerobically with PAO, and are often more dominant than PAO in deteriorated EBPR systems (Cech and Hartman, 1993; Liu et al., 1997b). However, the exact role of GAO in EBPR process is still not well understood. Figure 2.1 illustrates the phylogenetic relationships among the putative PAO and ‘GBacteria’/GAO (Seviour et al., 2003). To better understand the EBPR processes, it is necessary to understand the metabolisms of the three key biopolymers (PHA, glycogen and polyP) involved in the metabolisms of EBPR processes. Figure 2.1. A tree showing the phylogenetic relationships among the putative PAO and GAO (Seviour et al., 2003) 14 Chapter 2 2.2 Biological aspects of PHA PHAs represent a complex group of polyesters. They are produced by a variety of microorganisms, mainly to serve as carbon and energy storage under different stress conditions. Under conditions, such as nutrient limitation, PHAs are synthesized and deposited as insoluble inclusions in microbial cytoplasm. Currently, there are nearly a hundred different types of PHAs (Steinbuchel & Valentin, 1995), and 125 different hydroxyalkanoic acid (HA) monomer units are known as the monomers of PHAs (Rehm & Steinbuchel, 1999). The monomers are polymerized polymers with a molecular weight ranging from 200,000 to 3,000,000 Dalton. Monomers of PHA can be divided into short-chain-length (SCL) and medium-chain-length (MCL). SCL monomers consist of three to five carbon atoms (e.g. hydroxybutyrate and hydroxyvalerate), and MCL monomers consisting of six to fourteen carbon atoms (e.g. hydroxyhexanoate, hydroxyoctanoate and hydroxydecanoate) (Lee et. al, 1999). Figure 2.2 illustrates the molecular formulae of PHA units. Figure 2.2. Molecular formulae of PHA units: (a) hydroxybutyrate; (b) hydroxyvalerate; (c) hydroxymethylbutyrate; (d) hydroxymethylvalerate (Lee et al., 1999). 15 Chapter 2 PHAs exist as discrete inclusions, typically 0.2-0.5 µm in diameter, localized in the cell cytoplasm, and can be visualized quite clearly using light microscopy under phase contrast mode due to their high refractivity. PHAs can be specifically stained by the oxazine dye Nile Blue A, exhibiting a strong orange fluorescence at an excitation wavelength of 460 nm. In addition to staining methods, chemical analyses using gas chromatography (GC) and nuclear magnetic resonance (NMR) spectroscopy are often performed to determine their monomeric compositions of PHAs. 2.2.1 PHA synthase Three important enzymes are involved in the biosynthesis of PHA. The first enzyme, 3ketothiolase, catalyzes the reversible condensation of two acetyl-CoA moieties to form one acetoacetyl-CoA. This substance is then reduced to 3-hydroxybutyryl-CoA by the second enzyme, acetoacetyl-CoA reductase. PHA synthase then catalyzes the polymerization of monomers into PHA with the concomitant release of CoA. Among these three enzymes, PHA synthase has been identified as a key enzyme to determine the type of PHA synthesized by the micro-organisms. 2.2.2 Primary structure of PHA synthase Three different types of PHA synthases with respect to their substrate specificities and primary structures are known (Steinbüchel et al., 1992), and summarized in Figure 2.3. 16 Chapter 2 Type I: Represented by PHA synthase of Ralstonia. eutropha -35/-10 phaC 314 bp Type II: Represented by PHA synthase of Pseudomonas. oleovorans phaC1 phaC2 137 1039 bp Type III: Represented by PHA synthase of Chromatium. vinosum phaC phaE 57 bp -35/-10 150 bp Figure 2.3. Classification of PHA synthases based on their primary structures an substrate specificities. 17 Chapter 2 Type I PHA synthase is represented by the well-characterized PHA synthase obtained from Ralstonia. eutropha, and is involved in the synthesis of SCL HA monomers. It has been shown that small amounts of 3-hydroxyhexanioc acid (3HHx), (3-hydroxyoctamoic acid (3HO) units are also incorporated by the PHA synthase of R. eutropha (Dennis et al., 1998; Antonio et al., 2000). In some instances, Type I synthases are reported to incorporate 3HHx monomers. These PHA synthases are obtained from Aeromonas caviae (Fukui & Doi, 1997), Rhodospirillum rubrum (Brandl et al., 1989), Rhodocylus gelatinosus (Liebergesell & Hustede, 1991), Rhodococcus rubber (Haywood & Anderson, 1991) and Rhodobacter sphaeroides (Liebergesell et al., 1993b). Type II PHA synthases are known to efficiently incorporate larger (R)-3HA monomers containing at least five carbon atoms (termed MCL HA). It is represented by those PHA synthases obtained from Psuedomonas oleovorans (Huisman et al., 1991). Type III PHA synthase consists of two subunits designated as the phaC-subunit (MW of about 40 kDa) and phaE-subunit (MW of about 40 kDa) (Rehm & Steinbuchel, 1999), and is represented by the PHA synthase isolated from Chromatium vinosum (Leibergesell & Steinbüchel, 1992). In general, type III PHA synthase prefers SCL-HA (Rehm & Steinbuchel, 1999), with an exception from Thoicapsa. pfennigii that exhibits broad substrate specificity that includes both the SCL- and MCL- HA (Liebergesell et al., 1993b). PHA synthases have been isolated from a wide group of bacteria such as R. eutropha (Slater et al., 1988), A. Latus (Choi et al., 1998), Methylobacterium eutorquens (Valentin & 18 Chapter 2 Steinbuchel, 1993), A. catiae (Fukui & Doi., 1997), Acinetobacter. sp.(Schembri et al., 1994), P. oleovorans (Huisman et al., 1991), Pseudomonas sp. 61-3 (Timm & Steinbüchel, 1992), C. vinosum (Leibergesell & Steinbüchel, 1992) and Thiocystis violacea (Liebergesell et al., 1993a). Comparison of these PHA synthases revealed that these enzymes exhibit a high similarity in amino acid sequence (21-88 %) with six conserved blocks commonly found in the conserved regions among these three types of PHA synthases (Rehm & Steinbuchel, 1999). However, the N terminal region (about 100 amino acids relative to type I PHA synthases) is highly variable (Rehm & Steinbuchel, 1999). Studies into truncated R. eutropha PHA synthase revealed that the N-terminal region was dispensable for functionally active enzymes (Schubert et al., 1991). Overall, 15 amino acid residues have been found to be identical in all known PHA synthases, suggesting an important role of these residues for enzyme function. 2.2.3 Genes encoding enzymes involving in PHA synthesis Genes encoding for enzymes in PHA synthesis and degradation from a number of bacteria have been identified and characterized. They include phaA, phaB, phaC, phaG, phaJ, and phaZ. These genes and the enzymes they encode were listed in Table 2.1. Studies (Slater et al., 1988; Peoples & Sinskey, 1989; Steinbuchel et al., 1992; Liebergesell & Steinbüchel, 1992; Choi et al., 1998) showed that these genes are often clustered in the bacterial genomes with different organization. Among these genes, phaC, which codes for the PHA synthase, is considered to be the most significant, and, together with other genes involved in PHA metabolism, has been studied in detail. To date, at least 42 PHA synthase structural 19 Chapter 2 genes from various Gram-positive bacteria, Gram-negative bacteria, and cyanobacteria have been cloned and sequenced (Rehm & Steinbuchel, 1999). Table 2.1. Genes involved in PHA biosynthesis Genes Enzymes phaA 3-ketothiolase phaB NADP-dependent acetoacetyl-CoA reductase phaC PHA synthase phaG 3-hydroxyacyl-acyl carrier protein-CoA transacylase phaJ enoyl-CoA hydratase phaZ PHA depolymerise 2.2.4 Organization of PHA biosynthesis genes The PHA biosynthesis genes and the genes encoding for other proteins related to the metabolism of PHA are mostly clustered together as shown in Figure 2.4. In R. eutropha, A. latus and B. cepacia, phaC, phaA, and phaB consititute the phaCAB operon (Slater et al., 1988; Peoples & Sinskey, 1989; Steinbuchel et al., 1992). In many bacteria like Zoogloea ramigera, Methylobacterioum extorquens, Sinorhizobium meliloti, and Nocardia corain, phaC gene is separated from phaA, phaB or other genes related to PHA metabolism. In Pseudomonas sp. 61 - 3 and P. aeruginosa, two different phaC genes are identified and are separated by the phaZ gene. In Chromatium vinosum and Thiocystis violacea, a twocomponent PHA synthase was found (Liebergesell & Steinbüchel, 1992) with genes coding for the two components, phaC and phaE, directly linked inside an operon. These results 20 Chapter 2 suggest that although genes involved in PHA metabolism possess similar features, the structure and organization are diverse. a) phaC phaA phaC phaB phaA phaB b) c) d) phaC1 phaC phaZ phaC2 phaE phaA phaD phaB Figure 2.4. Molecular organization of PHA synthase genes involved in PHA metabolism These four types of gene organization are represented by PHA synthase genes of a) Ralstonia eutropha; b) Zoogloea ramiger; c) Pseudomonas aeruginosa and d) Chromatium vinosum respectively . 2.3 Biological aspects of glycogen Glycogen is one of the major energy storage units for almost all bacteria. It has been shown that glycogen accumulation occurs in a limitation of nutrients (e.g., N and P), in the presence of an excess source of carbon, or in the presence of suboptimal pH conditions (Preiss et al., 1983). In addition to its role as carbon and energy source for growth, glycogen is also known to provide energy for cell maintenance under non-growing conditions. Thus, the organisms with the ability to store glycogen often survive better than those without the ability of glycogen storage. In the EBPR system, glycogen is one of the 21 Chapter 2 key metabolites, and serves as the storage of carbon and energy sources in both PAO and GAO. 2.3.1 The nature of glycogen At the molecular level, glycogen is polysaccharide synthesized from glucose-1-phosphate (Figure 2.5). While the precise role of glycogen in bacteria is still unclear, it is suggested that glycogen can be used as a stored source of energy and carbon surplus (Strange, 1968). Furthermore, in bacteria, such as Bacillus subtilis and Streptomyces coelicolor, glycogen synthesis has been associated with sporulation and cell differentiation (Kiel & Boels, 1994; Martin & Schneider, 1997). In Salmonella enteritidis, glycogen synthesis is reported to be associated with biofilm formation and virulence (Bonafonte et al., 2000). In the EBPR system, glycogen is thought to play a key role in the regulation of the redox balance in PAO (Mino et al., 1998), and is necessary for the anaerobic assimilation and metabolism of a diverse range of readily biodegradable substrates in full-scale systems. Figure 2.5 Molecular formula of glycogen 22 Chapter 2 2.3.2 Enzymes involved in glycogen metabolism Glycogen is synthesized from glucose-1-phosphate (Glc-1-P) by a group of enzymes (Table 2.2). These include ADP-glucose pyrophosphorylase (ADP-Glc PPase, EC 2.7.7.27), glycogen synthase (EC.2.2.1.21), branching enzyme (BE, EC 2.4.1.18), and other enzymes like glycogen phosphorolase, phosphoglucomutase, glycogen debranching enzyme (Kumar et al., 1986). Metabolic pathways involved in the synthesis of glycogen in bacteria have been extensively studied (Preiss, 1989). Table 2.2. Enzymes involved in glycogen metabolism Glycogen synthesis: Glycogen degradation: Glycogen synthase Glycogen phosphorylase ADP-glucose pyrophosphorylase Phosphorylase kinase Branching enzyme cAMP-dependent protein kinase Phosphorylase phosphatase Phosphoprotein phosphatase Debranching enzyme ADP-Glc PPase, is one of the three important enzymes involved in glycogen biosynthesis. It converts Glc-1-P and ATP into ADP-glucose and pyrophosphate as follows: Glc-1-P +ATP → ADP glucose + Ppi Studies suggest that the reaction catalyzed by ADP-Glc PPase is a rate-limiting step in the pathway for glycogen biosynthesis. To date, ADP-Glc PPases have been isolated from various bacteria. These enzymes are known to be homotetrameric enzymes (Ko, 1996). 23 Chapter 2 Glycolytic intermediates are often found as activators, whereas orthophosphate and/or ADP and AMP are mostly found as inhibitors (Preiss, 1989; Preiss & Romeo, 1994). Based upon activator and inhibitor specificity, ADP-Glc PPase has been grouped into eight distinct classes as shown in Table 2.3 (Ballicora et al., 2003). Table 2.3 Relationships between carbon metabolism and regulatory and structural properties of ADP-Glc PPase from different organisms (Ballicora et al., 2003) Glycogen synthase plays a key role in glycogen metabolism (Ball & Morell, 2003). Glycogen synthase controls the principal regulatory step of glycogen synthesis, and catalyzes the addition of a glucose molecule from ADP-Glucose in an -1,4 linkage to a growing glycogen chain as follow: ADP glucose + α-1,4-glucan → α-1,4-glucosyl-glucan + ADP 24 Chapter 2 Although glycogen synthase can catalyze this reaction, it cannot initiate this reaction (Preiss & Romeo, 1994). So far, there has been no report on the post-translational modification or regulation of this enzyme. There are two forms of glycogen synthase. One is the independent active form, glycogen synthase I, and the other is the dependent form, glycogen synthase D. Glycogen synthase I can be converted into glycogen synthase D via phosphorylation. Branching enzyme (EC 2.4.1.18) is another important enzyme involved in glycogen metabolism. It hydrolyzes an α-1, 4-linkage within a pre-existing α-1,4-linked glucan and transfers a segment of chain in α-1,6 position. 2.3.3 Genes encoding enzymes involving in glycogen biosynthesis Table 2.4 lists the genes encoding the enzymes involved in glycogen synthesis. Genes glgC, glgA and glgB encode the three critical enzymes, ADP-glucose pyrophosphorylase, glycogen synthase and branching enzyme, respectively. Studies indicate that the genes encoding for the enzymes involved in biosynthesis are clustered in single or adjacent operons in a variety of bacteria (Romeo et al., 1989; Yang et al., 1996; Ugalde et al., 1998). However, the genetic organization and the regulation of the operons are different among different bacterial strains (Takata et al., 1997; Ugalde et al., 1998). The genes involved in the glycogen biosynthesis in E. coli have been cloned (Thomas et al., 1981), and are found to be arranged in the order of asd-glgB-glgC-glgA. 25 Chapter 2 Table 2.4. Genes encoding enzymes involved in glycogen metabolism Genes Enzymes glgA Glycogen synthase gene glgB Branching enzyme gene glgC ADP-glucose pyrophosphorylase gene glgP Glycogen phosphorolase gene glgX Glycogen debranching enzyme gene Different glg operons have been identified from a range of bacteria. These include the glgC-glgA gene cluster in Agrobacterium tumefaciens (Uttaro & Ugalde, 1994), and the glgBCDAP gene cluster in Bacillus stearochermophilus (Takata et al., 1997). These different glg gene clusters are shown in Figure 2.6. Sequence alignment shows that all the gene operons contain glgC gene followed by glgA gene. However, the organizations of the gene clusters vary among different bacteria. Although genes involved in glycogen metabolism are studied in detail in many bacteria, little is known about the gene information in responsible bacteria in the EBPR process. 26 Chapter 2 Figure 2.6 Comparison of the known bacterial glg operons. Schematic alignment of glg structural genes (with 1-kb approximate scale) from the following sources: Rb.s. (Rb. sphaeroides), Rb.c. (Rb. capsulatus), Ag.tu. (A. tumefaciens), E. coli , and Bac.stear. (B. stearothermophilus) (Igarashi & Meyer, 2000) 2.4 Polyphosphate The primary energy currency of living systems is the high-energy phosphoanhydride bond. A number of organisms (including bacteria, fungi, plants, and animals) store energy and phosphate in phosphate polymers of three to more than a thousand residues called polyphosphate - polyP (Kulaev, 1979). 2.4.1. The nature of polyP PolyP is an important polyanionic polymer consisting of thousands or more of Pi monomers linked by high-energy phosphoanhydride. The molecular structure of polyP is shown in Figure 2.7. PolyP is first isolated from yeast (Liebermann, 1890) and later in other micro-organisms (Baltzinger et al., 1986; Beauvoit et al., 1989; Castuma et al., 1995). 27 Chapter 2 As a high energy compound, polyP is now considered to be widely distributed among bacteria, blue-green algae, fungi, protozoa, and algae (Harold, 1966). The wide distribution of polyP in microorganisms suggests that this polymer is important for cell function, but its function remains to be further clarified (Kornberg et al., 1999). Figure 2.7. Inorganic polyphosphate. The value for n in the long chains is usually many hundreds. To date, several functions have been proposed for polyP from experimental data using pure cultures of bacteria and are summarized by Kornberg et al., (1999) and Kortstee & Appeldoorn (2000). Firstly, polyP is hypothesized to be involved in the regulation of intracellular concentrations of important metabolites such as ATP, ADP, and other nucleotides (Kulaev, 1983). Secondly, polyP acts as a source of ATP in the phosphorylation. PolyP:AMP phosphotransferase and adenylate kinase replace ATP as a phosphate donor of sugars, as a reserve of inorganic P, and as an intracellular buffer. Thirdly, polyP can supply cells with Mg2+ under Mg2+-limiting conditions and plays a vital role in heavy metal (e.g. cadmium) tolerance by excreting the metal via a metal phosphate transport system (Van & Abee, 1994). Lastly, polyP is involved in the regulation of cell differentiation in prokaryotes (Kornberg et al., 1999). In the EBPR system, where polyP 28 Chapter 2 can be detected as intracellular granules, polyP is assumed to act as an energy source for the anaerobic substrate assimilation and PHA synthesis (Keasling et al., 2000). 2. 4. 2 Biosynthesis of polyP PolyP biosynthesis in E. coli., Neisseria meningitides and Acinetobacter spp. has been studied extensively (Kornberg et al., 1999). In these organisms, ADP phosphotransferase (polyP kinase, PPK) is thought to be the enzyme primarily responsible for polyP biosynthesis. PPK is a homotetramer of 80-kDa subunits bound peripherally to the inner cell membrane (Akiyama et al., 1992), and catalyzes the reversible conversion of the terminal phosphate of ATP to polyP (Equation 1). nATP ←→ poly Pn + nADP (Equation 1) Exopolyphosphateses (PPX) is another important enzyme, which catalyzes the removal of the terminal phosphate of polyP (Akiyama et al., 1992). PPX, together with PPK, is known to remove polyP to maintain the dynamic balance of the polyP level (Akiyama et al., 1993). The genes encoding PPK (ppk) and PPX (ppx) have been cloned and expressed in E. coli (Ahn & Kornberg, 1990; Akiyama et al., 1992). It is found that both ppk and ppx are present in the same operon, and the expression of the two genes is regulated through Pho regulation, which responds to low Pi levels in the medium (Akiyama et al., 1993). It has been known that upstream of ppk and ppx gene operon, two putative PhoB boxes, are found 29 Chapter 2 in the promoter region. PhoB boxes are the regulatory factor in the Pho regulation. They respond to low Pi levels in the medium. However, little is known about how activations of the ppk and ppx genes are differentiated, and how the posttranscriptional controls is regulated (Akiyama et al., 1992; Akiyama et al., 1993). In addition to E. coli, ppk genes have been cloned from a number of bacteria, such as Klebsiella aerogenes (Kato, et al., 1993) and Pseudomonas aeruginosa 8830 (Zago et al., 1999). Recent determinations of the DNA sequences of ppk from diverse bacterial genomes have revealed a high degree of conservation (Kornberg et al., 1999). As shown in Figure 2.8, the PPK sequences from 15 bacterial species share a conserved region (i.e. identical amino acid residue at the same position for all the organisms). These bacteria included Deinococcus radiodurans, Synechocystis spp., Campylobacter coli, Acinetobacter calcoaceticus, etc. However, studies also showed no significant PPK homologies in a range of bacteria including Archaeoglobus fulgidus, Borrelia burgdorferi, Enterococcus faecalis, Methanobacterium thermoautotrophicum, Plasmodium falciparum, Streptococcus pyogenes, Thermotoga martima, Treponema pallidum, Bacillus subtilis, Haemophilus influenzae, and Saccharomyces cerevisiae (Kornberg et al., 1999). Since polyP is present in all cells, the absence of PPK in these species argues for other pathway of polyP synthesis other than PPK (Kornberg et al., 1999). 30 Chapter 2 Figure 2.8. Comparisons of polyphosphate kinase (PPK) sequences among 15 microorganisms. Black boxes: 100% identity; gray boxes: 60% identity (Kornberg et al., 1999) Studies have shown that fluctuations in polyP levels up to 100 to 1000 fold take place in response to a variety of signals relating to the limitations of certain nutrients and stresses (Kornberg et al., 1999). How these various signals lead to either polyP accumulation or its disposal and how they activate genes and stimulate the enzymes responsible for synthesis, storage, and removal of polyP are still unknown. In the early stage of polyP research, crucial questions exist at every level, such as biochemical, genetic, and physiological, and more investigation is needed. A recent study reported that PPK is found in uncultured organism in sludge carrying out EBPR metabolism (McMahon et al., 2002). From activated sludge dominated by Rhodocylus-like Bata-proteobacteria, four novel ppk homologes are found and a novel PPK retrieved. These findings provide new evidence for the involvement of PPK in polyP synthesis in the EBPR process and constitute a new set of tools for the study of polyP metabolism in activated sludge. 31 Chapter 2 2. 5 Cloning of PHA biosynthesis genes While the genes involved in PHA, glycogene and polyP synthesis are all important in EBPR process, this study focused on the genes involved in PHA synthesis. Rehm and Steibuchel (1999) have summarized eight different strategies to clone genes involved in PHA synthesis (Table 2.5). These approaches can be distinguished with respect to the time and effort required. The enzymatic approach (strategy A) screens clones for functional expression of PHA synthase genes involved in PHA biosynthesis. Strategy B obtains homologous gene probes after transposon mutagenesis and used them to identify the respective intact gene of the same genome. Strategy C uses heterologous gene probes prepared from the well characterized R. eutropha PHA synthase gene, and used them to identify corresponding genes in genomic libraries prepared from other bacteria. Similarly, strategy D uses short oligonucleotides designed according to the short and highly conserved stretches of PHA synthases, derived from the multiple alignments of PHA synthases, and employs them for screening. Strategy E purifies the PHA synthase protein first, then obtains the N-terminal amino acid sequence, and uses the amino sequence to design oligonucleotides probes for screening, using a genomic library. The most successful and widely applied strategy, was to screen genomic libraries for phenotypic complementation of a PHA-negative mutant or for conferring the ability to synthesize and accumulate PHA to a PHA negative wild type (strategy F). Recently, another strategy (Strategy G) was employed to clone heterologous phaC genes in a PhaC-negative mutant of Rhodobacter capsulatus utilizing the detoxifi- cation of the medium from fatty acids due to their incorporation into PHAs. The last strategy (Strategy H) is based on the fact that known PHA synthases are 32 Chapter 2 distinguished from other proteins but have a high degree of homology to each other. Therefore, a homology search in the data banks will result in the identification of genes encoding homologous proteins which are subsequently cloned by employing the PCR technique. It is possible to use BAC (Bacterial Artificial Chromosome) library to clone PHA biosynthesis genes. BAC vector is a modified bacterial F factor, and can accept a DNA insert up to 500 kb in length (Shizuya et al., 1992). In addition, BAC vectors also possess traditional plasmid selection features such as antibiotic resistance genes and polycloning sites within a reporter gene to allow insertion and inactivation. In comparison to yeast artificial chromosome (YAC), BAC library is relatively free of chimerism and insert rearrangements (Cai, et al., 1995; Kim et al., 1996; Boysen et al., 1997; Venter et al., 1996). Moreover, BAC inserts can be stably maintained because F factor genes (parA and parB) can prevent more than one BAC to be inserted into a bacterium (Shizuya et al., 1992; Cai et al., 1998). Since BAC clones are stored individually in an ordered BAC library, they can be archived and manipulated independently, and propagated in virus or yeast host. So far, the BAC library has been widely used for a variety of research purposes (Table 2.6). 33 Chapter 2 Table 2.5 Strategies for cloning of PHA synthase genes Strategy Principle and method applied A Enzymatic analysis B Homologous gene probes (hybridization) obtained by transposon mutagenesis C Heterologous gene probes (hybridization) obtained from well-characterized genes D Consensus oligonucleotides (hybridization or PCR technique) E Oligonucleotides derived from N-terminal or internal amino acid sequence of PHA synthases F Opaque colonies or fluorescent colonies in PHA-negative host after heterologous expression G Growth after detoxification of media due to removal of fatty acids H Analysis of genome sequence analysis and application of PCR technique 34 Chapter 2 Table 2.6. Applications using the BAC library as a tool. Application Reference BAC-end sequencing Venter et al., 1996 Boyson et al., 1997 STS-based mapping Bouck et al., 1998 Bridge gaps between DNA markers Wang et al., 1996 in large genomes. Nakamura et al., 1997 BAC contigs encompassing entire chromosomes Mozo et al., 1999 Map-based cloning of genes for Danesh et al., 1998 specific phenotypes Sanchez & Ilag, 1999 As probes in FISH Cai et al. 1995 Full-scale BAC-based genome sequencing Venter et al., 1998 35 Chapter 3 Chapter 3 Materials and Methodology 3.1 Materials 3.1.1 Main Equipments The names and descriptions of the equipment necessary for all the biological and molecular techniques were presented in Table 3.1. 36 Chapter 3 Table 3.1. Key equipments necessary for this study Name Usage Source CEQ 8000 Genetic Analysis System Sequencing BECKMAN DU800 spectrophotometer Detection of absorbance BECKMAN Electrophoresis Resolving DNA BIO-RAD Electroporation system: CELL-PORATOR Electroporation GIBCO BRL Pulse Control Power Supply Chamber Rack Voltage Booter Laminar-flow hood with UV sterilization Preventing contamination ESCO lamps LM-590R Orbital Shaker Incubator Cultivation Lab-Line PCR machine I cycler Amplifying DNA BIO-RAD PFGE CHEF gel system: Genomeic DNA BIO-RAd (30ºC ,37ºC) Incubators (30ºC, 37ºC, 55ºC) Elec Cell Electrophoresis Chef Mapper Cooling Module CHEF gel casting stand Refrigerated centrifuge: Biofuge fresco Centrifugation HERAEUS Refrigerator; -80ºC and -20ºC freezers Store of bacteria or DNA Sanyo UV Gel observation Vilber Lourmat 37 Chapter 3 3.1.2 Main supplies used in this study The main supplies for BAC library construction and screening were listed in Table 3.2. Table 3.2. Main supplies used in this study Name Usage Souce Disposable Plug Molds BAC library construction BIO-RAD Hand held plate replicator BAC library replication BIO-RAD 384-well microtiter plates BAC library storage GENETIX Micro-Electroporation Chamber Electroporation GIBCO BRL Regenerated Cellulose(RC) Dialysis Electroelution SPECTRUM Southern Blot Amersham Membranes Hybond-N+ Membrane 3.1.3 Bacterial strains, plasmid and media All bacterial strains and plasmid used in this study were listed in Table 3.3. K. limosa strain Lpha5T was grown on R2A agar (Table 3.4) at 30 °C for 25-30 d. Alcaligenes latus ATCC 17699 was used to extract genome DNA as template to amplify phaC gene using PCR method. The amplified DNA was used as a probe to screen the BAC library constructed for phaC gene. A. latus was grown at 30 °C for 1-2 d on Nutrient Agar, containing 3.0 g beef 38 Chapter 3 extract, 5.0 g peptone, 15.0 g agar in 1 liter distilled water with pH adjusted to 7.0. E. coli strains were routinely grown at 37 °C in Luria-Bertani (LB) containing 20 g LB Broth, and additional 15.00 g agar for LB agar in 1 liter of deionized H2O. In all cases, antibiotics were added to the medium when needed. Antibiotics used in this study included chloramphenicol, kanamycin, and ampicillin at a final concentration of 12.5 µg/ml, 50 µg/ml and 50 µg/ml, respectively. Isopropylthiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside were used when needed at concentrations of 20 µg/ml and 40 µg/ml, respectively. All transformant was cultivated in SOC medium (2 % Bacto tryptone, 0.5 % yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM Glucose, pH 7.0). 39 Chapter 3 Table 3.3 Bacterial strains and plasmid used in this study Bacterial strains Important character Source Kineosphaera limosa strain Lpha5T Function of accumulating PHA Lab stock Alcaligenes latus ATCC17699 Source of phaC gene probe ATCC ElectroMAXTM DH10BTM Cells Transformation by electroporation Invitrogen Library Efficiency DH5α Competent Efficient transformation of large Invitrogen Cells plasmid TransforMax EC100 Transformation Epicentre For cloning PCR product Invitrogen pBeloBAC11 BAC library construction vector Invitrogen pIndigoBAC-5 (BamHI-Cloning BAC library construction vector Epicentre pGEM®-7Zf(+) vector Cloning and sequenceing vector Promega PCR II TOPO vector Cloning and sequenceing vector Invitrogen Electrocompetent E.coli TOPO One shot Chemically Competent E.coli Ready) 40 Chapter 3 Table 3.4 Prescription for R2A medium. Name of the chemicals Weight (g) Yeast extract 0.50 Proteose Peptone 0.50 Casamino acids 0.50 Glucose 0.50 Soluble starch 0.50 Na-pyruvate 0.30 K2HPO4 0.30 MgSO4 x 7 H2O 0.05 Agar 15.00 Water 1000ml 3.1.4 Primers, enzymes, DNA markers and chemicals used Primers used in this study were listed in Table 3.5. The names and the characters of the enzymes and DNA markers used in this study were listed in Table 3.6. Other important chemicals used include molecular biology grade agarose, dimethyl sulfoxide (DMSO), ethylenediaminete traacetic acid (EDTA), ethanol, isopropanol, isopropylthiogalactoside (IPTG), phenylmethylsulfonyl fluoride (PMSF), ethidium bromide, sodium dodecyl sulfate (SDS), casamino acids, soluble starch, tris(hydroxymethyl)aminomethane (Tris), 5-bromo4-chloro-3-indolyl-beta-D-galactoside (X-GAL), LB broth, yeast extract, proteose peptone, and Na-pyruvate and glucose. 41 Chapter 3 Table 3.5 Primers used in this study Name phaCF1 Primer Sequencesa 5’-atcaacaar(g/a)tw(t/a)ctacr(a/g)tcy(c/t)s(c/g)gacct-3’ Reference Sheu et al., 2000 phaCF2 5’-gts(c/g)ttcr(g/a)ts(g/c)r(a/g)ts(c/g)w(t/a)s(c/g)ctggcgcaaccc-3’ Sheu et al., 2000 phaCR4 5’-aggtagttgty(c/t)gacs(c/g)m(a/c)m(a/c)r(a/g)tagk(g/t)tcca-3’ Sheu et al., 2000 F1: 5’-aagcatgctgcacagctcgtc This study F2: 5’-tagacctccagggtgtcct This study F3: 5’-agaggtgatcgtcagggagc This study F4: 5’-atgggtgaggaagcctccat This study F5: 5’-tcgatggtggcgaagtggg This study a r (g/a), w (t/a), y (c/t), s (c/g), m (a/c), k (g/t) 42 Chapter 3 Table 3.6 Enzymes and DNA markers used in this study Name of restriction enzyme Sequences or important characters Source Bam HI G/GATCC NEB EcoR I G/AATTC NEB Hind III A/AGCTT Promega MspI C/CGG Promega Nde I CA/TATG NEB Not I GC/GGCCGC NEB Pst I CTGCA/G Promega Rsa I GT/AC Promega Sph I GCATG/C Promega Xba I T/CTAGA NEB Alkaline Phosphatase, Remove 5’ phosphatase from NEB Calf Intestinal (CIP) DNA/RNA Lysozyme Break cells wall and outer membrane of Sigma bacteria Proteinase K Inactivate endogenous nucleases Sigma RNase, DNA-free Digest RNA in DNA islation procedures Roche TaKaRa Ex TaqTM Amplify DNA by PCR TaKaRa T4 DNA ligase Ligate cohesive/blunt end of DNA/RNA NEB Lambda DNA Molecular weight maker Promega 1kb DNA Ladder Molecular weight maker ranging from 0. NEB 100bp DNA Ladder Molecular weight maker ranging from 1 NEB MidRange PFG Maker I Molecular weight maker for PFGE. Size NEB range:15-300kb Lambda DNA/Hind III Molecular weight size makers Fragments CEQ Terminator Cycle Life Technologies Sequencing BECKMAN Sequencing with Quick Start COULTER Kit 43 Chapter 3 3.2 Methods 3.2.1 BAC library construction 3.2.1.1 DNA manipulation 3.2.1.1.1 Preparation of high-molecular-weight DNA, DNA plugs and plasmid DNA Bacteria cells were harvested from R2A plate, and resuspended in 10 ml buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris). Lysozyme was added to a final concentration of 1 mg/ml, and the mixture was incubated at 37 °C for 0.5-1 h. SDS (final concentration, 1%) and proteinase K (final concentration 200 µg/ml) were added, and the mixture was incubated at 55 °C for 2 h, with occasional inversion. Then, 1/3 volume of 5 M NaCl and 1 volume of chloroform was added to the mixture, and incubated at room temperature for 0.5 h with frequent inversion. The mixture was then submitted to centrifugation at 6,000 rpm for 10 min, and the supernatant was collected. To precipitate DNA, 0.6 volume of isopropanol was added, and DNA was collected by centrifuging at 13,000 rpm for 20 min. DNA pellet was washed with 70 % ethanol and dried at room temperature. DNA stock solution was prepared by dissolving DNA in 50 µl TE buffer. To make DNA plugs, the DNA stock solution was mixed with equal volume of 1.6 % agarose solution, the mixture was embedded into pre-chilled plug casts, and the plugs were allowed to solidify on ice for 30 min prior to storage at 4 °C. Isolation of plasmid was carried out as described by Sambrook et al. (1989). 44 Chapter 3 3.2.1.1.2 Recovery of partially digested DNA - Electroelution Partially digested DNA with expected size in agarose gel was recovered from gel slices using electroelution method (Strong et al., 1997). Dialysis tubing was pretreated by heating the membrane at 90 oC in 1 mM EDTA, 2 % NaHCO3 for 10 min, boiling in H2O for 10 min, rinsing several times in H2O, and then finally storing at 4 oC in 50 % ethanol. Immediately prior to use, the membrane was rinsed thoroughly in sterile H2O and then in sterile 1 X TAE buffer. For electroelution, a gel slice was placed lengthwise into the pretreated dialysis bag with one end sealed with a dialysis clip. The dialysis bag was filled with sterile 1 X TAE buffer, and air in the bag was removed carefully before sealing the other end with another dialysis clip. The bag was submerged completely in the gel electrophoresis chamber close to the negative pole by putting several glass slides on top of the bag to prevent it from floating in the buffer solution. Electroelution was carried out using a field strength of 4-5 V/cm. After 2 h of electrophoresis, the polarity was reversed for exactly 1 min to dissociate the DNA from the membrane side. The eluted DNA was used for ligation. 3.2.1.1.3 Recovery of DNA from agarose gel DNA embedded in agarose gels was extracted with QIAquick Gel Extraction Kit using the protocol provided by the manufacturer. 45 Chapter 3 3.2.1.2 Partially Restriction Enzyme Digestion Restriction enzyme BamHI and HindIII were used to digest Lpha5T genome DNA. DNA plugs were equilibrated in 1 X TE buffer overnight. Enzyme was added at different final concentrations to partially digest the genome DNA. DNA plugs were loaded into 1 % agarose gel, and DNA was size-fractionated by pulse-field gel electrophoresis (PFGE). For this, the partially digested DNA embedded in DNA plugs was loaded onto the wells of 0.8% agarose gel in pre-cooled 0.5 X TBE, and sealed in the wells with the same molten agarose. The electrophoresis was performed on a CHEF Mapper (BIO-RAD) in 1 X TBE buffer at 14 °C at 6.0 V/cm for 18 h. The initial switch time and final switch time was 3 s and 8 s, respectively, and the included angle was 120°. Gel slices containing DNA of the appropriate size were cut out and collected by electroelution (Strong et al., 1997). 3.2.1.3 Ligation of DNA fragments to plasmid vector Restriction enzyme digested DNA fragments were ligated to plasmid vector, which was digested with the same restriction enzyme and dephosphorylated. Ligation reaction was performed as described by Sambrook et al. (1989). About 50-200 ng of size-selected DNA was ligated in a molar ratio of 1:3 to 1:5 with HindIII or BamHI-digested, dephosphorylated pBeloBAC11 in a total volume of 100 µl using 10 units of T4 DNA ligase. The ligation reaction was carried out at 16 °C for 16 h followed by heating at 65 °C for 15 min to terminate the reaction. 46 Chapter 3 3.2.1.4 Electroporation and heat shock transformation The ligation mixture was transformed in E.coli ElectroMAXTM DH10B competent cells by electroporation method (Sheng et al., 1990) using a Bio-Rad GenePulser instrument. In brief, micro-electroporation chambers within a chamber rack were pre-cooled on the control compartment of the chamber safe with approximately 250 ml of ice-water slurry. A vial of E. coli ElectroMAXTM DH10BTM cells (100 µl) was thawed on ice, and 3 µl of the freshly prepared DNA ligation was added and mixed. The cell-DNA mixture was transferred into the pre-cooled micro-electroporation chamber with caution to avoid bubbles, because the pressure of a bubble could cause arcing and loss of the sample. The lid of the chamber safe was closed and secured with the draw latch. The resistance on the Voltage Booster (Cell Porator) was set on 4,000 ohms (4 kΩ), and the pulse control unit to “LOW” and the capacitance to 330 µF. The pulse control unit was charged up to 300 volts. Then the pulse was discharged by pressing the trigger button for 1 s. The transformation mixture samples were inoculated into culture tubes containing 1 ml of fresh prepared SOC media and incubated at 37 °C for 1 h with shaking at 250 rpm. To perform heat-shocked transformation, 3-5 µl of ligation reaction was added into a vial containing DH5αcompetent cells and incubated on ice for 5 to 30 min. The mixture was heat-shocked for 45 s at 42 °C without shaking and immediately transferred onto ice and incubated for 30 min. 47 Chapter 3 For both electroporation and heat shock transformation samples, 50, 100 and 150 µl of transformed cells were spreaded onto LB agar plates containing selected antibiotics (12.5 µg/ml CM or 50 µg/ml Amp), 25 µg/ml X-gal, and 50 µg/ml IPTG. Plates were incubated at 37 °C overnight. After 16 h of growth, white colonies containing inserts were clearly distinguishable from blue colonies without inserts, and were chosen for further studies. 3.2.1.5 Construction and replication of BAC library BAC clones were picked and inoculated in microtiter plates containing frozen media [2.5 % LB broth, 13 mM KH2PO4, 1.7 mM sodium citrate, 6.8 mM (NH4)2SO4, 4.4 % glycerol and 40 mM MgSO4 12.5 ug/ml chloramphenicol] to create an ordered BAC library. Individual white colonies were picked up using a sterile toothpick and placed into a single well. The inoculated microtiter plates were cultivated at 37 °C overnight. These plates constituted a “master copy” of the BAC library, and were used as templates for producing replicate copies of the BAC library. All the microtiter plates were stored at - 80 °C. 3.1.2.6 Characterization of BAC library To determine the quality of a BAC library, the average insert size and the average number of clones hybridized with a probe specific for single copy gene were evaluated. To evaluate the average insert size of the library, the average insert size of 20-50 BAC clones per ligation was first determined during library construction. After the completion of library construction, the average sizes of inserts from 300 single random clones were determined 48 Chapter 3 by first isolating the plasmid DNA from 300 BAC clones. The isolated plasmid DNA was digested with restriction enzyme BamHI or HindIII at 37 °C for 2.5 h. The digestion mixture was then loaded onto 0.8% agarose gel and the average size of BAC inserts was determined. 3.2.2 Screening and evaluation of BAC library 3.2.2.1 Probe preparation by PCR amplification Genomic DNA from a PHA-accumulating bacterial strain A. latus ATCC 17699 was extracted and used as DNA template for PCR amplification of a DNA fragment containing the phaC gene. This fragment was used as a specific probe for the screening of phaC gene of those BAC clones using Southern hybridization. The degenerated primers were synthesized as described by Sheu et al. (2000). The primers were phaCF1 (corresponding to nucleotide 741-766 of R. eutropha phaC), phaCF2 (corresponding to nucleotide 846-871 of R. eutropha phaC) and phaCR4 (corresponding to nucleotide 846-871 of R. eutropha phaC). PCR conditions used to amplify the phaC gene probe from the genomic DNA of A. latus was the same as described by Sheu et al. (2000). The optimized colony PCR reaction mixture (per 25 µl) contained 1 x PCR amplification buffer [20 mM (NH4)2SO4, 72.5 mM Tris/HCl, 0.1 % Tween 20, pH 9.0], 2.5 mM MgCl2, 200 µM each deoxynucleotide triphosphate, 2.5 µM each primer (phaCF1 and phaCR4), 1.25 U Taq DNA polymerase in 49 Chapter 3 25 µl PCR reaction mixture. A final concentration of 100 µg/ml of acetylated BSA, 3 % dimethyl sulfoxide (DMSO) and 1 M betaine were also added as PCR additives to the reaction mixture. Colonies approximately 1 mm in diameter were picked up with a sterilized toothpick and directly transferred to the PCR tubes as DNA templates. The thermal cycle program consisted of one cycle of 94 °C for 10 min, 51 °C for 2 min, 72 °C for 2 min, and 35 cycles of 94 °C for 20 s, 57 °C for 45 s (decreased by 1 s per cycle), 72 °C for 1 min, and then incubation at 72 °C for 5 min, and a final incubation at 4 °C. Semi-nested PCR was further used since there was no PCR product band observed on agarose gel from the first PCR reaction. Semi-nested PCR was performed with the primers phaCF2 and phaCR4 and 1 µl of PCR product from the first PCR reaction as DNA templates. The PCR mixture in a final volume of 25 µl contained 1x PCR amplification buffer, 1.5 mM MgCl2, 200 µM each deoxynucleotide triphosphate, 2 µM each primer (CF2 and CR4), 2% DMSO and 0.5 U Taq DNA polymerase. The thermal cycle programme was 94 °C for 5 min (initial denaturation), 25 cycles of 94 °C for 15 s, 57 °C for 15 s, 72°C for 30 s, and then incubated at 72 °C for an additional 5 min, with final incubation at 4 °C. 50 Chapter 3 3.2.2.2 Transfer and cultivation of BAC clones on nylon membrane All the BAC clones were inoculated onto Hybond N+ membranes with a hand held plate replicator. The membranes were placed on LB agar plates containing 12.5 µg/ml chloramphenicol and cultivated at 37 °C for 12 to 36 h until colonies of 1 to 2 mm diameter were obtained. The membranes were removed and placed with colony side up on a pad of absorbent filter 3 M Whateman paper soaked within 5 % SDS, followed by heating in a microwave-oven for 10 min to release DNA from the BAC bacteria cells. The membranes were air dried at room temperature overnight and stored at 4 °C. 3.2.2.3 BAC library screening by Southern Hybridization and autoradiography Hybridization and autoradiography were performed according to the standard procedures described by Sambrook et al. (1989). Completely digested genomic DNA with BamHI was examined under 1.0 % agarose gel. The agarose gel containing the size-fractionated DNA was placed on the top of a Hybond-N+ membrane, and fragmented DNA was transferred onto the membrane by passive diffusion mechanism. Membranes containing the target DNA were treated with prehybridization solution containing 6 X SSC, 5 X Denhardt’s reagent, 0.5 % SDS, 100 µg/ml denatured, fragmented salmon sperm DNA, and incubated at 55 °C for 6 h in a hybridization tube. The prehybridization solution was completely removed and replaced with hybridization solution containing 4 µl of labeled probe, 10 µl of DNA (5 pg/µl), and 31 µl of 1 X TE buffer. Hybridization probe amplified from A. latus was labeled with [32P] ATP at the 5'-end of DNA fragments with T4 polynucleotide kinase 51 Chapter 3 (New England BioLabs). Freshly prepared radiolabeled probe was heated for 3 min at 100 °C and chilled rapidly on ice before added into the hybridization tube. After hybridization at 55 °C overnight, the membranes were rinsed with 0.4 N NaOH, followed by 0.1 X SSC at 55 °C. Then the membrane was wrapped with plastic wrap, and placed on top of an Xray film (Kodak) at -70 °C for 24 to 72 h before the autoradiography signals were measured by the Kodak X-ray film processor. 3.2.2.4 Cloning, hybridization and sequencing of targeted DNA fragments DNA fragments identified by Southern Hybridization were isolated and cloned into pGEM®-7Zf(+) vector. To further confirm that the cloned fragment could hybridize with the phaC gene probe, Southern hybridization was performed with the DIG DNA labeling and detection kit according to the procedure described by the manufacturer. After successful cloning, targeted DNA fragment was sequenced using an ABI 3100 Genetics Analyzer. 52 Chapter 4 Chapter 4 Results 4.1 BAC library construction from Lpha5T To construct the BAC library for strain Lpha5T, genome DNA of Lpha5T was first partially digested into suitable size using restriction enzyme HindIII. However, no partial digested fragments were generated (Figure 4.1), likely due to the high G + C content of genomic DNA of Lpha5T. Thus, to investigate its restriction profile, the Lpha5T genomic DNA was further digested with several other restriction enzymes, including BamHI, EcoRI, HindIII, MspI, SphI, XbaI, RsaI, PstI, NotI, and NdeI. The results showed that Lpha5T genomic DNA could be digested into smear by restriction enzymes BamHI, MspI, SphI, PstI, NotI, and NdeI, whist no obvious digestion was observed by restriction enzymes EcoRI, HindIII, XbaI, and RsaI. The digested profile of the Lpha5T genome DNA was summarized in Table 4.1. 1 2 3 4 Figure 4.1. Lpha5T genome DNA total digestion by HindIII and BamHI Lane 1: genome DNA; Lane2: genome DNA/BamHI Lane 3: genome DNA/HindIII; Lane 4: λDNA/HindIII 53 Chapter 4 Table 4.1. Restriction Enzyme digestion characteristics of Lpha5T genomic DNA Restriction enzymes Recognizing sites Digestion characteristics BamHI G/GATCC + EcoRI G/AATTC - HindIII A/AGCTT - MspI C/CGG + Not I GC/GGCCGC + Pst I CTGCA/G + Rsa I GT/AC - Sph I GCATG/C + Xba I T/CTAGA - Note: +: totally digested into smear - : couldn’t be digested For constructing the BAC library for strain Lpha5T, genomic DNA of Lpha5T partially digested with restriction enzyme BamHI was used, and ligated with BamHI-Cloning Ready vector. After transformation, BAC clones, which appeared on X/I/C LB plates (supplemented with X-gal, IPTG and Chloramphenicol) as white colonies, were selected (Figure 4.2). In total, 7680 clones were selected and arrayed in twenty 384-well plates. 54 Chapter 4 transformant Figure 4.2 Lpha5T Transformants on X/I/C LB plate To evaluate the size of those insert DNA fragments in the library, 300 clones were randomly selected and cultivated in LB media containing 50 μg/ml chloramphenicol. After plasmid extraction from individual colonies and restriction enzyme digestion, the insert sizes were evaluated using electrophoresis on agarose gel. Figure 4.3 shows part of the BACs plasmid digestion patterns. Among those 300 BAC clones, 295 contained inserted DNA (98.3%). For these positive clones, majority of them (80.3%) contained inserts DNA length between 15-35 kb with an average size of 23.5 kb as shown in Figure 4.4 using BamHI as the restriction enzyme. 55 Chapter 4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 No. of clones Figure 4.3. BamHI digestion patterns of randomly selected BACs from Lpha5T BAC library Lane 1: λDNA/HindIII Marker; Lane: 2, 21: 1kb Marker; Lanes 3-20: BAC/BamHI 90 80 70 60 50 40 30 20 10 0 0-5 5.1-10 10.1-15 15.1-20 20.1-25 25.1-30 30.1-35 35.1-40 40.1-45 Fragment Size (kb) Figure 4.4. Distribution of the insert sizes from 300 randomly selected recombinant BACs digested with Bam HI 56 45.1-50 Chapter 4 Furthermore, plasmid DNA extracted from selected BAC clones was digested with restriction enzyme HindIII. The electrophoresis result indicated that HindIII was not able to digest plasmid DNA from those selected BAC clones (Figure 4.5). This observation supported the inability of using HindIII as the restriction enzyme for partial digestion of genomic DNA from Lpha5T. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Figure 4.5. HindIII digestion of plasmid from Lpha5T BACs Lanes 1-15: Lpha5T BACs/HindIII; Lane 16: 1kb Maker 4.2 Screening of Lpha5T BAC library for phaC gene Clones containing phaC gene in the BAC library constructed were further screened using southern hybridization. The hybridization probe (~ 376 bp) was prepared by PCR amplification of a short DNA fragment from the phaC gene of strain A. latus. The amplified PCR product was sequenced and compared with GenBank using BLAST search. The result showed that the PCR fragment was closely related to the phaC gene from Alcaligenes sp. with 83% identity. Thus, the PCR product was subsequently used as a specific probe for phaC gene to screen the Lpha5T BAC library. 57 Chapter 4 In total, 6144 BAC clones were screened using the PCR amplified probe. Results from the dot blot experiment in Figure 4.6 showed that positive clones were hybridized by the PCR probe. In total, 18 clones were identified. The positive BACs expressed as αβγ (α, plate number in BAC library; β, row number in a plate; γ, line number in a plate) included 1K10, 1G18, 1L14, 3O8, 4J5, 6C13, 7M7, 8H13, 9A3, 10F12, 11B22, 12J5, 13C11, 13M15, 14A4, 14D12, 14O2, and 15M19. Positive clone Figure 4.6. Dot blot showing positive clones hybridized with probe for phaC gene Ten of the 18 positive clones were further randomly selected and used for further study. Plasmid from these clones was extracted and totally digested with restriction enzyme BamHI. Figure 4.7 showed that the complete restriction enzyme digestion patterns of those plasmid DNA from individual clones. Nine of the plasmid contained a 2.5 kb fragment. The digested plasmid DNA fragments were transferred onto a nylon membrane for Southern hybridization analysis. The membrane was hybridized with the PCR-amplified probe labeled with [32P] ATP and examined using autoradiography. The result from Figure 4.8 indicated that the 2.5 kb fragments were hybridized by the probe. This 2.5 kb fragment was observed to be present in nine of the ten positive clones. 58 Chapter 4 1 2 3 4 5 6 7 8 9 10 11 12 2.5 kb Figure 4.7. Total digestion of plasmid from positive clones Hybridized with probe for phaC gene Lane 1: 1kb maker; Lane 2: λDNA/HindIII Maker; Lanes 3-12: digested plasmid 1 2 3 4 5 6 7 8 9 10 11 12 2.5 kb Figure 4.8. Membrane hybridization showing a positive 2.5 kb fragment Lane 1: λDNA/HindIII Maker; Lanes 2-11: BACs; 12: Negative 59 Chapter 4 To further characterize the 2.5 kb fragment hybridized by the probe, the fragment was purified and cloned into vector pGEM®-7Zf(+). To confirm whether the plasmid constructed contained the insert that hybridized with the phaC gene probe, plasmid was extracted and analyzed using Southern Hybridization. The extracted plasmid was digested with restriction enzyme BamHI and the electrophoresis result showed an insert DNA fragment with a correct size of 2.5 kb (Figure 4.9). In addition, to confirm whether the fragment was phaC gene positive, the DNA fragment was transferred onto nylon membrane and Southern Hybridization was carried out with the probe for phaC gene using DIG-labeling system. The Southern Hybridization result as shown in Figure 4.10 proved that the cloned 2.5 kb DNA fragment could hybridized with phaC gene probe. 1 2 3 4 5 3.0 kb 2.5 kb Figure 4.9. BamHI digestion of the constructed plasmid before Southern Hybidization Lane1: λDNA/HindIII Marker; Lanes 2-5: plasmid constructed 60 Chapter 4 1 2 3 4 5 2.5 kb Figure 4.10 Image after hybridization with DIG labeled probe Lane 1: λDNA/HindIII Marker; Lanes 2-5: positive plasmid 4.3 Sequencing and Annotation of the fragment cloned To sequence the 2.5 kb DNA fragment hybridized by the specific phaC gene probe, it was cloned into pGEM®-7Zf(+) vector and defined as phaP2. The fragment was sequenced using primer walking. The sequence contains a total of 2186 bases, which was listed in Figure 4.11. The distribution of ACGT along the strand was A: 14.18% (310 nt), T: 16.24% (355 nt), G: 41.03% (897 nt) and C: 28.45 % (622), resulting in a GC content of 69.48%. There were two ambiguous bases within the fragment (0.09% of total fragment length). Molecular weight (single stranded) of this fragment was 709.80 kDa. The primers (F1, F2, F3, F4 and F5 as discussed in section 3.1.4) used for sequencing were highlighted in italics in Figure 4.11. Further, open reading frame (ORF) analysis, restriction enzyme analysis and Basic Local Alignment Search Tool (BLAST) analysis were performed to characterize the sequence. 61 Chapter 4 ORF1 1 AGCATCTCGTGGAGCCGGCGAGCCAACTTCATGTACTGGGCCATCTTGTT M 51 I L L GGCGCCGAAAAGGTCCACCCGTTGCAGGGTTTCCAGGGTGCGGTCGGCTC A 101 Y W A P K R S T R C R V S R V R S A P CGAGATCCCAGTAGGGGATCTTGCTGTCATCCAGGCGCACCGGGATCAGC R S Q 151 CAGGTGTGGCCCGGGGCGTACTGGCGGAACTCCTCGGCGGCGACGGCGAG 201 CTCCGCGTTTTGATACGACTTCGCGCGGCCGTGGGAGTTCTGCGAGAAAC 215 AGGCGAGGAACACCAAGGAGCCCTCTCGGATGGCCTGCTTGATCTTCATC 301 TCCCACATATCGCCCGGGCCGAGTTCATCCCGGTCGCGCCAGTAGGGGAT Primer F1 351 CTCTGCTGCCCGAAGCATGCTGCACAGCTCGTCCACGGCGGCGGCATCCT 401 CGTGCCGGTAGGAGATGAACACGTGGGGGGTCGAGTCAGAGGCCATGAGA 451 GGAGCATAGAGACTCACCGGAACACTCAAGACGGGGCCTTGACCTGGGGG ORF2 501 CATGGGAGTAGGGCAGGCGCCGGTGGTGGGCTCGCCGCGGGGGAGTCGGC M 551 G G Q A P V V G S P R G S R P CCTGCCCGCGAGCGCTTCACGCGCTCGCGGGCGGTGTTGTCAGCGGGGGT C 601 V P R A L H A L A G G V V S G G CAGTGTGGCCCAGGGCCCAGTCCCCGAGGTGCCAGCTGAGCCCGTGGGGG Q C G P G P S P R G A S Primer F2 651 GTCTCGGCCTCCACGTAGACCTCCAGGGTGTCCTCGGGGTCGGGGTGGCC 701 GTGGCCGTCCAGGGCGGCGGCGAGGCTGCGGTGCAGCTCGGTCAGGTGGG 751 CGGGAATCTCCGCGTTGAGGGCGAGGGCGGGCTGGTCGGTGTAGACCCAG 801 GGGGTGAGGGCGCCGGCGCGGTTGCTGGCGGCGGTGAGGTTCAGCCAGCC ORF 3 851 GTTCTTGATCAGGCTCACCCCCACGGGGTCGGCGCGCAGCTCGATGCGGT M 62 R S Chapter 4 901 CCGTCGGGTCGCACTGGGCCAGGTGCCGGCGGAAGCCGGCCACGGAGTGC V 951 G S H W A R C R R K P A T E C AGACCCATCACCAGCGTGGGCAGCGGAGGCTCCGTCCGGGTCGGTGTCGT R P I T S V G S G G S V R V G V V Primer F3 1001 CAGCGGGGTCGGCGTAGGCGCGAGAGAAGCTGGCCGGGGTTCCAGAGGTG S G V G V G A R E A G R G S R G D 1051 ATCGTCAGGGAGCCGTCGGGCTGGGAGGCGATGGCCACGCCGCCGCCGTC R Q G A V G L G G D G H A A A V 1101 GGGGTCGGTCGTGGTGGCGGCCAGGCGGGCGGCTGCGGAGCCGGCATGCA G V G R G G G Q A G G C G A G M Q 1151 GGGCGGCGGTCAGGACGGCGGGGTGGAAGGTGAGCGTGGCCATGGGGGCC G G G Q D G G V E G E R G H G G L 1201 TCCTTGGGTTGGGGTGCTGGGGGCCTCATGCCCCTTGCGACATGAATAAG L G L G C W G P H A P C D M N K 1251 GCTACATGTTCACCGGGGGTGTGTGCAAGACGGTGCACACCCCCGCTGAC A T C S P G V C A R R C T P P L T 1301 CTCAGCCTCGGCGCCGAGACAACACGGCCCCCGCAGCGACCCCCGCTGCC S A S A P R Q H G P R S D P R C P ORF4,Primer F4 1351 CCCGCGGCCCATGGCACCCACCCTCGCCGGCGAGGAGACGGGATGGGTGA R G P W H P P S P A R R R D G M G E 1401 GGAAGCCTCGATTGGCGCCGAGGCAGGCGGCAGGGGAGTGACCTCCGCAG E A S I G A E A G G R G V T S A V 1451 TCCCCTCGAGGCCCGGAGGTGTCAGCGGGGCGGTCGTGCGGCTGAGGAAT P S R P G G V S G A V V R L R N 1501 AGCGGAGTCAGGACCCGGATGACGAAGGAGATGGCCAGCATGATGGCGAT S G V R T R M T K E M A S M M A M 1551 GGTCCAGATGGCGCTGGTGTGCGCAGGGTCAGGTACCGGATTCTTGGTGA V Q M A L V C A 63 G S G T G F L V S Chapter 4 1601 GCTGGTCGAGCGCCATCAGGACGCCGGCGACGGGCAGCATGGTGCCCACG W S S A I R T P A T G S M V P T 1651 GAGGCCAGGAAGAAGATCCAAGTGGGCGCCTCGCGTCCCTCCCGCAAGGC E A R K K I Q V G A S R P S R K A 1701 CTCCCCTATGTGATCCCAGAGGGGGAAGGCTGTGAGGGCATAGAGCCCCA S P M 1751 CGGCGGTGACGACAGCCACCCAGAAGTTGGCGGGGTCGTAGTGGGCTTCG 1801 GTGGTGGCCATGAGGGTGCAGGTCATGCGGCCATCCTTGCGGAGAGGGTG 1851 ACCCGCGAGCGCCCCGCGCGGGCGGGGTGCTCGCGGGTGGGGGTCACTGC Primer F5 ORF 5 1901 TGGTGGCGGCAGGTCTCGCAGATGTGGGGGGTGTCCTTGCCGTCGATGGT M W G V S L P S M V 1951 GGCGAAGTGGGCGGTGAGGGCCTTGATCCCGGTCTGGGTGAGGCGCTGCC A K W A V R A L I P V W V R R C Q 2001 AGAGGTCGTGGTGGGTGCGGATCTCGCGGGCGTTGGGGGTGTCCTCGAGG R S W W V R I S R A L G V S S R 2051 ATCGCGGTCAGGGACATGGGGGCGTGCTTGCGGCAGGTGATCATGCCGTT I A V R D M G A C L R Q V I M P L 2101 GAGGTTCATCCANGCNGGGGCGGTGGTGGTGTTGCTCATGGTGTCCTCCT R F I X A G A V V V L L M V S S 2151 TGGACGGGGGGGCTGGGGTTCCGGTGAACCCCTGCT D G G A G V P V N P C Figure 4.11 Nucleotide sequence of the 2,186 bp fragment, along with the deduced amino acid sequence of the five ORFs found within the fragment. The start codon ATG and stop codon TGA are underlined. Primers for primer walking were highlighted and in italics. 64 L Chapter 4 To predict the potential protein-coding regions, analysis of ORFs was performed. The 2,186 bases sequence was subjected to DNAStar software to find the ORFs. Firstly, ORFs, which consisted of sequences longer than 50 sense codons starting with ATG were searched. In total, five ORFs were found within the sequence (if two ORFs overlapped on either strand, the longer one was chosen). They were designated as ORF1, ORF2, ORF3, ORF4, and ORF5. The number of nucleotide contained in each ORF was 84, 138, 507, 321 and 265 bp, respectively. All the five ORFs were translated into amino acid sequences. Each of the five ORFs encoded a peptide with a length of 27, 45, 168, 106 and 88 amino acids, respectively. Further, the five ORFs were analyzed to determine their specific features, including the nucleotide range in the fragment, molecular weight, %G+C, number of amino acids encoded, number of strongly basic(+) amino acids (K,R), strongly acidic(-) amino acids (D,E), hydrophobic amino acids (A,I,L,F,W,V) and polar amino acids (N,C,Q,S,T,Y) encoded by the ORFs. The G+C content of the five ORFs was 60.71%, 73.56%, 72.98%, 66.98% and 66.79%, respectively. ORF3, ORF4, ORF5 contained amino acids that were strongly basic, strongly acidic, hydrophobic and polar amino acids, whilst ORF1 and ORF2 lacked strongly acidic amino acids. The features of the five ORFs were summarized in Table 4.2. 65 Chapter 4 Table 4.2 Features of the five Open Reading Frames within the sequence cloned ORF ORF1 ORF2 ORF3 ORF4 ORF5 31-114 502-639 894-1400 1393-1713 1922-2186 3188.8 4192.81 16669.73 10797.6 9658.76 84 138 507 321 265 %C+G 60.71 73.56 72.98 66.98 66.79 Number of amino acids 27 45 168 106 88 Strongly Basic (+) amino acids (K,R) 7 4 23 14 11 Strongly acidic (-) amino acids (D,E) 0 0 10 5 2 Hydrophobic amino acids (A,I,L,F,W,V) 9 12 38 33 43 Polar amino acids (N,C,Q,S,T,Y) 8 9 32 25 14 Position in the fragment Molecular Weight (Daltons) Number of nucleotide 66 Chapter 4 The longest ORF, ORF3, was found to consist of 507 nucleotides and encode a protein of 168 amino acids (designated Lbp) with a calculated molecular mass of 17 kDa. To analyze the potential restriction enzyme recognization sites within each ORF, sequences of the five ORFs were subjected to NEBcutter (http://tools.neb.com/NEBcutter2/index.php). The results showed that each ORF could be digested by a number of restriction enzymes, displaying a digestion profile. The restriction maps derived from each of the ORFs were shown in Figures 4.12 - 4.16. Figure 4.12 Restriction map of ORF 1 67 Chapter 4 Figure 4.13 Restriction map of ORF 2 Figure 4.14 Restriction map of ORF 3 68 Chapter 4 Figure 4.15 Restriction map of ORF 4 Figure 4.16 Restriction map of ORF 5 69 Chapter 4 To compare the ORFs sequence (potential novel gene sequences) with known gene sequences in the data bank, the five ORFs were subjected to BLAST against GenBank for further analysis to find any similarity to the known genes in GenBank. Three kinds of analysis including blastn (compares a nucleotide query sequence against a nucleotide sequence database), blastx (compares a nucleotide query sequence translated in all reading frames against a protein sequence database) and blastp (compares an amino acid query sequence against a protein sequence database) were performed. The output showed that all the five ORFs had no apparent similarity to known phaC genes in databases. However, each of the ORFs encoded a peptide, which shares some similarities with known genes, although the similarity is small. For example, ORF3 showed some similarity to part of the predicted mRNA gene of Oryza sativa, while ORF5 to Actinomadura hibisca strain JCM 9627 HSP70 gene. The peptides encoded by ORF4 and ORF5 showed some similarity to LysR-type transcriptional regulator and glycosyltransferase of Streptomyces antibioticu, respectively. The first two BLAST Hits of each ORF were listed in Table 4.3. 70 Chapter 4 Table 4.3. Summary of the first two BLAST Hits of each ORF Blast Hits of ORF1 (84bp) Blast type First Match Second Match Nocardia farcinica IFM 10152 Mycobacterium DNA, N-N complete avium subsp. genome, paratuberculosis str. k10, section, hypothetical protein hypothetical protein Identities = 24/25 (96%) Identities = 23/24 (95%), N-P No significant similarity found P-P No significant similarity found NB: N-N: Blastn, compares a nucleotide query sequence against a nucleotide sequence database. N-P: Blastx, compares a nucleotide query sequence translated in all reading frames against a protein sequence database. P-P: Blastp, compares an amino acid query sequence against a protein sequence database. 71 Chapter 4 Blast Hits of ORF 2 (138bp) Blast type First Match Second Match Symbiobacterium thermophilum Homo sapiens 12 BAC RP11DNA, complete genome, formate 162A11 (Roswell Park Cancer dehydrogenase associated protein Institute, Human BAC Library) complete sequence N-N Identities = 23/23 (100%) Identities = 21/21 (100%) hypothetical protein CNBN0690 hypothetical protein CNN00710 [Cryptococcus neoformans var. [Cryptococcus neoformans var. N-P P-P neoformans B-3501A] neoformans JEC21] Identities = 13/36 (36%), Identities = 13/36 (36%) No significant similarity found NB: N-N: Blastn, compares a nucleotide query sequence against a nucleotide sequence database. N-P: Blastx, compares a nucleotide query sequence translated in all reading frames against a protein sequence database. P-P: Blastp, compares an amino acid query sequence against a protein sequence database. 72 Chapter 4 Blast Hits of ORF3 (507bp) Blast type First Match Second Match Homo sapiens chromosome 1 Oryza sativa (japonica cultivarclone RP11-6B6 group), predicted mRNA Identities = 29/31 (93%) Identities = 22/22 (100%) N-N Hpothetical protein XP_346886 CG5847-PA [Drosophila [Rattus norvegicus] melanogaster], Identities = 19/40 (47%) Identities = 18/51 (35%) N-P hypothetical protein XP_346886 CG5847-PA [Drosophila [Rattus norvegicus] melanogaster] Identities = 19/40 (47%) Identities = 18/51 (35%) P-P NB: N-N: Blastn, compares a nucleotide query sequence against a nucleotide sequence database. N-P: Blastx, compares a nucleotide query sequence translated in all reading frames against a protein sequence database. P-P: Blastp, compares an amino acid query sequence against a protein sequence database. 73 Chapter 4 Blast Hits of ORF4 (321bp) Blast type First Match Second Match Mus musculus chromosome 5, Silicibacter pomeroyi DSS-3, clone RP23-325M7 complete genome Identities = 22/22 (100%) Identities = 28/30 (93%) cytochrome b [Pygathrix cytochrome b [Rhinopithecus nemaeus] roxellanae] Identities = 16/50 (32%) Identities = 16/50 (32%) N-N N-P LysR-type regulator P-P transcriptional hypothetical [Ralstonia protein eutropha [Bradyrhizobium bll5322 japonicum JMP134] USDA 110] Identities = 21/72 (29%) Identities = 29/87 (33%) NB: N-N: Blastn, compares a nucleotide query sequence against a nucleotide sequence database. N-P: Blastx, compares a nucleotide query sequence translated in all reading frames against a protein sequence database. P-P: Blastp, compares an amino acid query sequence against a protein sequence database. 74 Chapter 4 Blast Hits of ORF5 (256bp) Blast type First Match Second Match Actinomadura hibisca strain JCM Signal 9627 HSP70 gene, partial cds N-N N-P kinase transduction histidine [Magnetospirillum magnetotacticum MS-1] Identities = 20/20 (100%) Identities = 19/59 (32%) hypothetical protein MAP3031 hypothetical protein SSO2101 [Mycobacterium avium subsp. [Sulfolobus solfataricus P2] paratuberculosis str. k10] Identities = 18/47 (38%) Identities = 25/55 (45%) glycosyltransferase hypothetical protein MAP3031 [Streptomyces antibioticus] [Mycobacterium avium subsp. P-P paratuberculosis str. k10] Identities = 24/67 (35%) Identities = 18/47 (38%) NB: N-N: Blastn, compares a nucleotide query sequence against a nucleotide sequence database. N-P: Blastx, compares a nucleotide query sequence translated in all reading frames against a protein sequence database. P-P: Blastp, compares an amino acid query sequence against a protein sequence database. 75 Chapter 5 Chapter 5 Discussion 5.1 Construction of BAC library K. limosa strain Lpha5T is reported to possibly involved in the EBPR process, and accumulate PHA (Liu et al., 2002). To study the genetic information involved in the EBPR system, especially the PHA metabolic pathway, bacterial strain Lpha5T was used as a representative in this study. Some strategies such as a clone library, mutation analysis and enzymatic analysis have been used to retrieve genomic information from a bacterial genome, and can to some degree provide genetic information on a genome. However, these methods could not reveal the total information of a genome. Therefore, the purpose of this study was to construct genomic libraries containing the total genetic information from the representative, and to further isolate the gene(s) involved in the PHA accumulation pathway. Although a variety of genomic libraries such as the YAC library, the BAC library, and the cosmid library could be used for this purpose, the BAC library was used in this study. The BAC library serves to integrate genetic information, providing direct access to stable material that may be utilized for the purpose of multiple molecular analyses (Shizuya, et al., 1992). It also allows efficient hybridization to screen the entire library simultaneously using specific probes, since the BAC clones could be attached onto nylon filters at high density. Although the BAC library is commonly used to clone 80-200 kb DNA fragments from genomes of plants or animals (Cai et al., 1995; Kim et al., 1996), our result demonstrated 76 Chapter 5 that the BAC library is also suitable for the cloning of bacterial genome, with shorter average insert size, for example, 20-30 kb in this case. The smaller fragments size was more appropriate for bacteria species since bacterial genome is much smaller than that of plants, or animals. Therefore, using smaller fragment size, a lot of extra work and effort on subcloning could be avoided. To evaluate the average insert size of the BACs in the library, 300 BAC clones were randomly selected, 98.3% (295) of them contained inserts, and among the 300 BAC clones screened, 80.3 % (241) of them contained inserts of a DNA length ranging between 15-35 kb. These results suggested that transformation efficiency is very high in this study, and that the BAC vector could be used to accept shorter insert fragment suitable for the analysis of bacterial genome. Another challenge encountered in BAC library construction is the prevention of genome DNA degradation. Intact genome DNA is normally extracted from agarose plugs with tissue or bacterial cells embedded within (Shizuya, et al., 1992; Kim et al, 1996). However, in this study, genomic DNA from K. limosa strain Lpha5T could not be extracted using this traditional method. A possible reason for this could be that the bacterial cells of Lpha5T were clustered together, hence leading to the failure to break the cells and release the DNA from the cells. Therefore, in this study, a modified method was adapted. The genomic DNA was first extracted from bacterial cells in liquid medium, This DNA stock solution was mixed with an equal volume of agarose solution, and the mixture was then embedded into a pre-chilled plug cast to make the DNA plug, and result showed that the genomic DNA extracted using this modified method was intact for library construction; and thus, 77 Chapter 5 demonstrating an improvement over the more traditional method of genomic DNA extraction. In the process of constructing the Lpha5T BAC library, partial digestion is a key step to obtain the suitable DNA fragment size. It was found that the Lpha5T genome could not be digested with restriction enzyme HindIII, whilst the BAC vector was HindIII-Cloning ready. As a result, we decided to investigate the restriction profile of its genome. Nine representative restriction enzymes were used to digest the Lpha5T DNA. The result, as shown in Figure 4.1, demonstrated that the genome of Lpha5T could be digested by restriction enzymes BamHI, MspI, NotI, PstI and SphI, all of which contain at least 4 G or C within the restriction enzyme recognized sites. In contrast, Lpha5T genome could not be digested by restriction enzyme EcoRI, HindIII, RsaI and XbaI, which recognize G/AATTC, A/AGCTT, GT/AC and T/CTAGA, respectively. These results were in agreement with the genomic characteristic of high G+C content of the Lpha5T genome, and, therefore, necessitated the use of BamHI, instead of HindIII, during partial digestion. To investigate whether there are any modification systems in the bacterial Lpha5T cells, the genome DNA should be digested into fragments to understand the fragments’ restriction digestion profile within another host, such as E. coli. In this study, we used the randomly selected BACs from the Lpha5T BAC library as samples. Figure 4.5 showed that Lpha5T BAC plasmid, which was multiplied in host E. coli, could not be digested by enzyme HindIII. This result further supported the observation that the recognition site for restriction enzyme HindIII is less frequent than other restriction enzymes tested within Lpha5T 78 Chapter 5 genome. All these results demonstrated that the restriction enzyme digestion feature is a critical element, which should be carefully considered in partial digestion procedures when a BAC library is constructed. 5.2 Preparation of probe To screen a BAC library for a specific gene based on the hybridization approach, an important step is to find a representative probe sequence for the gene. It has been documented that bacterial strain Lpha5T has the function to accumulate PHA in its cell (Liu et al., 2002). It is also known that all bacterial strains with the PHA accumulating function contain the conserved PHA synthase gene, phaC (Rehm & Steinbuchel, 1999). Therefore, it could be postulated that strain Lpha5T could contain the phaC gene in its genome. Primers have been designed based on the alignment of conserved region in known phaC genes (Sheu et al., 2000). Using these primer sets, part of the phaC genes have been amplified from a variety of bacteria strains, which lead to the cloning of phaC gene from these bacteria, such as R. eutropha, A. latus, Azotobactor chroococcum and P. putida (reviewed in Chapter 2, Section 2.2.3). Thus, in this study, we aimed to amplify part of phaC gene from Lpha5T to be used as probe to screen the Lpha5T BAC library. However, although many experiments have been carried out to amplify the phaC gene from Lpha5T genome DNA using known primer sets (phaCF1/CR4 and phaCF2/phaCR4), no PCR product of the phaC gene could be retrieved from Lpha5T genome. This result indicated that the primer sets were not specific for the phaC gene in Lpha5T genome. Consequently, part of the phaC gene was amplified from A. latus ATCC17699 and later used as the probe 79 Chapter 5 to screen the Lpha5T BAC library for phaC gene, since all known phaC genes share conserved regions. 5.3 Sequence analysis In this study, a 2186 bp fragment that hybridized with the phaC gene probe was cloned and sequenced. When sequencing was first carried out, the fragment could not be read using the reverse primer M13R, whilst a sequence of >500 bp was obtained using the forward primer M13F in one reaction. Subsequently, the primer SP6 was used to replace the primer M13R; however, the sequence obtained was only 90 bp. It could be suspected at this point that the secondary structure was formed within this fragment, presumably due to the high G+C content. This was partially supported by the observation that 71.3 % of the Lpha5T genome was of G+C content (Liu et al, 2002). The secondary structure could reduced polymerase accessibility to the target site and hence affected the sequencing process using SP6/M13R primer. Another possible reason could be that the nucleotides could interact with each other via hydrogen bonds forming Watson-Crick base pairs, wobble base pairs, and Hoogsteen base pairs. Since there are three hydrogen bonds between G and C (compared to only two between A and T), the fragment with high G+C content could form stable hydrogen bonding that would possibly prevent the formation of ssDNA from dsDNA during the denaturing steps in the sequencing reaction. Both of the possible reasons were partially supported when the fragment was sequenced using primer walking method, and was shown to contain a high G+C content of 69.49 % (i.e. 1.81% difference from the entire genome) of the Lpha5T genome. 80 Chapter 5 Our presumption is also partially supported by other studies. It is reported that there are local, sequence-dependent modulations of structure, which are primarily associated with changes in the orientation of bases (Drew & Traver, 1985). In addition, different base sequences have their own characteristic signature, which can affect groove width, helical twist, curvature, mechanical rigidity, and resistance to bending (Karlin & Burge, 1995). Moreover, it is known that there are two distinct conformations of the DNA double helix. At high humidity (and low salt) the dominant structure is known as B-DNA; and at low humidity (and high salt) the favoured form is A-DNA. In 1979, a quite different structure was discovered, namely a left handed helix formed by a synthetic hexamer d(CGCGCG), now known as a Z-DNA (Wang et al., 1979). The fragment cloned in this study has a high G+C content of 69.49 %, it possibly has its own characteristic signature and could partially fold into Z-DNA. 5.4 Gene annotation In this study, a 2186 bp DNA fragment was cloned and sequenced. However, interpreting the sequence of the fragment presents a challenge. Although ORF searching revealed five ORFs, BLAST result showed that it was not the homologue to the phaC gene, which was supposed to be isolated. It was possible that the clone identified by the library screening revealed a false positive due to the nature of the sequence itself. It has been noted above that the probe used to screen the BAC library was amplified form A. latus. The hybridization signal may have come from the binding of the probe with non-specific sequences because of its high G+C content. Upon further analysis, the fragment was found to possess certain significant features within the sequence. Five ORFs were found within 81 Chapter 5 the fragment, and they may code certain proteins with some specific functions, although the functions remain unknown. Moreover, ORF3 predicted a proline rich region. It is known that in mammalian cells, this motif codes for the Src-homology 3 (SH3) binding domain, which is a small protein of about 60 amino-acid residues (Musacchio et al., 1992). It was first identified as a conserved sequence in the non-catalytic part of several cytoplasmic protein tyrosine kinases e.g. Src, Abl, Lck (Mayer et al., 1988). Since then, it has been found in a great variety of other intracellular or membrane-associated proteins (Musacchio et al., 1992; Pawson & Schlessingert, 1993; Mayer B.J.& Baltimore D., 1993). The SH3 domain has a characteristic fold consisting of five or six beta-strands arranged as two tightly packed anti-parallel beta-sheets. The linker regions contain short helices (Kuriyan & Cowburn, 1993). Current understanding about the function of the SH3 domain is that they mediate assembly of specific protein complexes via binding to proline rich peptides (Morton & Campbell, 1994). SH3 domains have been identified in a variety of proteins with enzymatic activity, such as mammalian Ras GTPase-activating protein (GAP) (Briggs et al., 1995), adaptor proteins mediating binding of guanine nucleotide exchange factors to growth factor receptors e.g. vertebrate GRB, drosophila DRK, miscellaneous proteins interacting with vertebrate receptor protein tyrosine kinases e.g. Crk, cytoskeletal proteins, fodrin and yeast actin binding protein (ABP-1) (Morton & Campbell, 1994). This proline rich region is very important in eukaryotic cells, however, the exact role of the proline rich region in bacterial cells is not entirely clear. While genomics is moving forward very fast, and more and more of DNA sequence information becomes available, the proteome (the entire set of proteins) is still not well understood. Further research effort would be required to improve the understanding of protein functions, as well as their structure and 82 Chapter 5 characteristics. This will enhance the current understanding of biological systems at the cellular level. Although the five ORFs were not homologous to the known phaC genes, some of them partially share some similarities with other known genes, and the proteins they code have some similar functions as known proteins. For example, ORF1 has similarity to part of the hypothetical protein found in Mycobacterium avium subsp. paratuberculosis str. k10; and ORF2 is partially similar to the formate dehydrogenase associated protein of Symbiobacterium thermophilum; It was also found that ORF3 is partially identical to the predicted mRNA sequence of Oryza sativa (japonica cultivar-group), and ORF4 to LysRtype transcriptional regulator in Ralstonia eutropha JMP134. ORF5 was revealed to HSP70 gene of Actinomadura hibisca strain JCM 9627; Signal transduction histidine kinase of Magnetospirillum magnetotacticum MS-1. Overall, this study has failed to retrieve correct DNA sequence encoding the PHA synthase. This was possibly due to the inability to obtain a good PCR-product based probe to screen the BAC library. 83 Chapter 6 Chapter 6 Conclusion and Recommendation 6.1 Conclusion The BAC library, which contains the total genetic information of K. limosa strain Lpha5T was constructed. The library was represented by 7280 BAC clones with an average insert size of 23.5 kb. The library was stored in arrayed plates at high density from efficient identification of BAC clones and was also attached onto hybridization filters. Consequently, the BAC library could be maintained for further genomic investigation work from the time it was first constructed in this study. Screening of the Lpha5T BAC library using Southern blot hybridization with a probe specific for the phaC gene identified 18 positives clones. The 18 positive clones were further digested with restriction enzyme BamHIII, and a fragment was found to be able to hybridize with the phaC gene probe amplified from A. latus ATCC17699. Hence, the fragment was isolated and cloned into the vector pGEM®-7Zf(+). However, sequencing this fragment, using the primer walking process, revealed that this 2186 bp fragment was not homologous to the known phaC genes. This may imply, however, that there could possibly be other pathway(s) for PHA accumulation in the K. limosa strain Lpha5T. Further work is required to understand the pathway(s) that could be involved in the PHA accumulation function in this strain. 84 Chapter 6 The 2186 bp fragment, hybridized with the phaC gene probe was cloned and sequenced. The sequence results demonstrated that the fragment contained a G+C content of 69.49 mol %, which is similar to the 71.3% G+C of the genome (Liu, et al., 2000). Although this fragment is not homologous to the known phaC gene, five ORFs were identified within this fragment, and they encode peptides with lengths of 27, 45, 168, 106 and 88 amino acids, respectively. ORF5 encodes a peptide without end in this particular fragment. Although the exact functions of these peptides remain unknown, their amino acid length suggested specific functions. Therefore, further works are required to understand those functions. Additionally, ORF3 encodes a proline rich region, which is known to be the SH3 domain in mammalian cells. However, the exact function(s) in bacterial cells is/are unknown. Although the 2186 bp fragment was not the homologue of known phaC genes, this study was successful in establishing an experimental framework suitable for bacterial BAC libraries. In the process of constructing conventional eukaryotic BAC libraries, the plant or mammalian cells would normally be embedded in plug to extract the genomic DNA for the purpose of keeping the genome intact. However, in this study, bacteria Lpha5T genomic DNA could not be extracted using this method. In order to recover intact genomic DNA from Lpha5T, a modified method was developed. The Lpha5T genome was first extracted in liquid medium, digested in the liquid system with restriction enzyme BamHI, and then mixed with melting agarose gel before being embedded in plugs. The result showed that high molecular weight DNA could be recovered by this improved method. Therefore, this particular study provides a useful method for genomic DNA extraction from bacterial cells existing in high density in cultures. 85 Chapter 6 In addition, this study also substituted the conventional gelase technique by electroelution to recover large DNA fragment from agarose gel because electroelution could reduce the heat-induced DNA damage. Our results showed that DNA fragment recovered by this method is highly qualified for the subsquent ligation reactions. Overall, the Lpha5T BAC library constructed in this study provides a basis for further investigation into the genetic information of the bacterial strain Lpha5T. Moreover, the 2186 bp fragment, which was cloned and sequenced in this study, identified some new peptides, which may have potentially important functions in bacterial cells. 6. 2 Recommendation As indicated in the results section, the bacterial strain Lpha5T could not be digested by restriction enzyme HindIII, which recognizes A/AGCTT sequence, even in the E.coli host. This result suggested that digestion of the Lpha5T genome with a certain rare enzyme, which is rich in A/T in its recognizing site, may result in breaking the genome into only several fragments when subjected to PFGE. The fragment sizes could be estimated accurately by comparing appropriate molecular weight markers. Therefore, the genome size could be estimated accordingly. A similar method was used to organize the genome of Clostridium perfringens (Canard & Cole, 1989). In addition, since known primers for the phaC gene could not amplify the phaC gene from K. limosa Lpha5T in this study, it is maybe necessary to design new primer sets for this 86 Chapter 6 strain. It is known that Lpha5T strain is a Gram-positive bacteria with high G+C content. Therefore, alignment analysis should be carried out from bacterial strains sharing similar features to either identify a potential phaC gene, or to obtain an appropriate phaC probe. Although this study failed to isolate phaC gene from the Lpha5T genome, a 2,186 bp fragment was cloned and sequenced. Annotation to this fragment revealed five ORFs, which encode peptides with very interesting hypothetical functions. Further studies are required to understand the function of these hypothetical ORFs. 87 References: Ahn K. & Kornberg A. (1990). Polyphosphate kinase from Escherichia coli. J. Biol. Chem. 265:11734–39 Akiyama M., Crooke E. & Kornberg A. (1992). The polyphosphate kinase gene of Escherichia coli. J. Biol. Chem. 267: 22556-22561 Akiyama M., Crooke E. & Kornberg A. (1993). An exopolyphosphatase of Escherichia coli. The enzyme and its ppx gene in a polyphosphate operon. J. Biol. Chem. 268: 633-639 Amann R., Ludwig W. & Schleifer K. H. (1995). Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143-169 Amann R. (2000). Who is out there? Microbial aspects of biodiversity. Syst. Appl. Microbiol. 23: 1-8 Anderson A. J. & Dawes E. A. (1990). Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol Rev. 54: 450-472 Antonio R. V., Steinbuchel A. & Rehm B. H. (2000). Analysis of in vivo substrate specificity of the PHA synthase from Ralstonia eutropha: formation of novel copolyesters in recombinant Escherichia coli. FEMS Microbiol Lett. 182: 111-7 Auling C., Pilz F., Busse H. J., Karrasch S., Streichan M. & Schon G. (1991). Analysis of the polyphosphate-accumulating microflora in phosphorus-eliminating, anaerobic– aerobic activated sludge systems by using diaminopropane as a biomarker for rapid estimation of Acinetobacter ssp.. Appl Env. Mrobiol. 57: 3585–92 Ball S. G. & Morell M. X. (2003). From bacterial glycogen to starch: understanding the biogenesis of the plant starch granule. Annu Rev Plant Biol. 54: 207-33 88 Ballicora M. A., Iglesias A. A. & Preiss J. (2003). ADP-glucose pyrophosphorylase, a regulatory enzyme for bacterial glycogen synthesis. Microbiol. Mol Boil.Rev. 67: 213-225 Baltzinger M., Ebel J. P. & Remy P. (1986). Accumulation of dinucleoside polyphosphates in Saccharomyces cerevisiae under stress conditions: High levels are associated with cell death. Biochimie. 68: 1231–36 Bark K., Sponner A., K.ampfer P., Grund S. & Dott W. (1992). Differences in polyphosphate accumulation and phosphate adsorption by Acinetobacter isolates from wastewater producing polyphosphate: AMP phosphotransferase. Water Res. 6: 1379–88 Beauvoit B., Rigonlet M., Guerin B. & Canioni P. (1989). Polyphosphates as a source of high energy phosphates in yeast mitochondria: a P-NMR study. FEBS Lett. 252: 17–22 Bonafonte M. A., Solano C., Sesma B., Alvarez M., Montuenga L., GarciaRos D. & Gamazo C. (2000). The relationship between glycogen synthesis, biofilm formation and virulence in Salmonella enteritidis. FEMS Microbiol. Lett. 191: 31-36 Bond P. L., Hugenholtz P., Keller J. & Blackall L. L. (1995). Bacterial community structures of phosphate-removing and nonphosphate removing activated sludges from sequencing batch reactors. Appl Environ Microbiol. 61: 1910–6 Boysen C., Simon M. I. & Hood L. (1997). Fluorescence-based sequencing directly from bacterial and P1-derived artificial chromosomes. Biotech. 23: 978-982 Brandl H., Knee E. J., Fuller R. C., Gross R. A. & Lenz R. W. (1989). Ability of phototrophic bacterium Rhodospirillum rubrum to produce various poly(β- hydroxyalkanoates): potential source for biodegradable polyesters. Int J Biol Macromol. 11: 49-55 89 Brdjanovic D., Slamet A., Van Loosdrecht M. C. M., Hooijmans C. M., Alaerts G. J. & Heijnen J. J. (1997). Impact of excessive aeration on biological phosphorus removal from wastewater. Water Res. 32: 200-208 Briggs S. D. Bryant S. S., Jove R., Sanderson S. D. & Smithgall T. E. (1995). The Ras GTPase-activating protein (GAP) is an SH3 domain-binding protein and substrate for the Src-related tyrosine kinase, Hck. J Biol Chem. 270: 14718-14724 Bouck J., Miller W., Gorrell J. H., Muzny D. & Gibbs R. A. (1998). Analysis of the quality and utility of random shotgun sequencing at low redundancies. Genome Res. 8: 1074–1084 Cai L., Taylor J. F., Wing R. A., Gallagher D. S., Woo S. S. & Davis S. K. (1995). Construction and characterization of a bovine Bacterial Artificial Chromosome library. Genomics. 29: 413-425 Cai W. W., Reneker J., Chow C. W., Vaishnav M. & Bradley A. (1998). An anchored framwork BAC map of mouse chromosome 11 assembled using multiplex oligonucleotide hybridization. Genomics. 54: 387-397 Canard D. & Cole S. T. (1989). Genome organization of the anaerobic pathogen Clostridium perfringens. Proc. Natl. Acid. Sci. 86: 6676-6680 Castuma C. E., Huang R., Kornberg A. & Reusch R. N. (1995). Inorganic polyphosphates in the acquisition of competence in Escherichia coli. J. Biol. Chem. 270:12980–12983 Cech J. B. & Hartman P. (1990). Glucose induced breakdown of enhanced biological phosphorus removal. Environ. Technol. 11: 651-656 90 Cech J. S. & Hartman P. (1993). Competition between polyphosphate and polysaccharide accumulating bacteria in enhanced biological phosphate removal systems. Water Res. 27: 1219-1225 Choi J. I., Lee S. Y. & Han K. (1998). Cloning of the Alcaligenes latus polyhydroxyalkanoate biosynthesis genes and use of these genes for enhanced production of poly(3-hydroxybutyrate) in Escherichia coli. Appl Env. Mcrobiol. 64: 4897–4903 Christensson M., Blackall L. L. & Welander T. (1998). Metabolic transformations and characterization of the sludge community in an enhanced biological removal system. Appl. Microbiol. Biotechnol. 49: 226-234 Conley D. J. (2000). Biogeochemical nutrient cycles and nutrient management strategies. Hyrdobiologia. 410: 87-96 Crocetti G. R., Hugenholtz P., Bond P. L., Schuler A., Keller J., Jenkins D. & Blackall L. L. (2000). Identification of polyphosphate-accumulating organisms and design of 16S rRNA-directed probes for their detection and quantitation. Appl Environ Microbiol. 66: 1175-1182 Daims H., Bruhl A., Amann R., Schleifer K. H. & Wagner M. (1999). The domain specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set. Syst. Appl. Microbiol. 22: 434-444 Danesh D., Pefiuela S., Mudge J., Denny R. L., Nordstrom H., Martinez J. P. & Young N. D. (1998). A bacterial artificial chromosome library of soybean and identification of clones near a major cyst nematode resistance gene. Theor. Appl. Genet. 96:196-202 Drew H. R. & Travers A. A, (1985). DNA bending and its relation to nucleosome positioning. J Mol Biol. 186: 773-90 91 Fuhs G. W. & Chen M. (1975). Microbiological basis of phosphate removal in the activated sludge process for treatment of wastewater. Microbiol Ecol. 2: 119-138 Fukui T. & Doi Y. (1997). Cloning and analysis of the poly(3-hydroxybutyrate-co-3hydroxyhexanoate) biosynthesis genes of Aeromonas caviae. J Bacteriol. 179: 4821-4830 Harmsen H. J., Kengen H. M., Akkermans A. D., Stams A. J. & de Vos W. M. (1996). Detection and localization of syntrophic propionate-oxidizing bacteria in granular sludge by in situ hybridization using 16S rRNA-based oligonucleotide probes. Appl Environ Microbiol. 62: 1656-63 Harold F. M.(1966). Inoganic polyphosphates in biology: structure, metabolism, and function. Bacteriol. Rev. 30: 772-794 Haywood G. W. & Anderson A. J. (1991). Accumulation of a poly (hydroxyalkanoate) copolymer containing primarily 3-hydroxyvalerate from simple carbohydrate substrates by Rhodococcus sp. NCIMB 40126. Int J Biol Macromol. 13: 83-88 Hesselmann R. P. X, Werlen C, Hahn D, van der Meer J. R. & Zehnder A. J. B. (1999). Enrichment, phylogenetic analysis and detection ofa bacterium that performs enhanced biological phosphate removal in activated sludge. Syst. Appl. Microbiol. 22: 454–465 Huisaman G. W., Wonink E., Meima R., Kazemier B., Terpstra P. & Witholt B. (1991). Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. Identification and sequences of genes and function of the encoded proteins in the synthesis and degradation of PHA. J Biol Chem. 266: 2191-2198 Igarashi R. Y. & Meyer C. R. (2000). Cloning and sequencing of glycogen metabolism genes from Rhodobacter sphaeroides 2.4.1. Expression and characterization of recombinant ADP-Glucose Pyrophosphorylase1. Arch. Biochem. Biophy. 376: 47–58 92 Jenkins D & Tandoi V. (1991). The applied microbiology of enhanced biological phosphate removal: accomplishments and needs. Water Res. 25: 1471–1478 Karlin S. & Burge C. (1995). Dinucleotide relative abundance extremes: a genomic signature Trends Genet. 11: 283–290 Kato J. Yamamoto T. Yamada K. & Ohtake H. (1993). Cloning, sequence and characterization of the polyphosphate kinase-encoding gene (ppk) of Klebsiella aerogenes. Gene. 137: 237-42 Kawaharasaki M., Kanagawa T., Tanaka H. & Nakamura K. (1998). Development and application of 16S rRNA-targeted oligonucleotide probe for detection of the phosphateaccumulating bacterium Microlunatus phosphovorus in an enhanced biological phosphorus removal process. Wat. Sci. Tech. 37: 481-484 Keasling J. D., Van Dien S. J., Trelstad P., Penninger N. & Mcmahon K. (2000). Application of polyphosphate metabolism to environmental and biotechnological problems. Biochemistry. 65: 324-331 Kiel J. A. & Boels J. M. (1994). Glycogen in Bacillus subtilis: molecular characterization of an operon encoding enzymes involved in glycogen biosynthesis and degradation. Mol. Microbiol. 11: 203–218 Kim U. J., Birren B. W., Slepak T., Mancino V., Boysen C., Kang H. Y., Simon M. I. & Shizuya H. (1996). Construction and characterization of a human bacterial artificial chromosome library. Genomics. 34: 213-218 Ko J. (1996). Purification and characterization of a thermostable ADP-glucose pyrophosphorylase from Thermus caldophilus GK-24. J. Biochem. 319: 977-983 93 Konberg A. (1995). Inorganic polyphosphate: toward making a forgotten polymer unforgettable. J. Bacreriol. 177: 491-496 Kornberg A., Rao N. N. & Ault-Riche D. (1999). Inorganic polyphosphate: a molecule of many functions. Annu. Rev. Biochem. 68: 89–125 Kortstee J. & Appeldoorn J. (2000). Ecological aspects of biological phosphorus removal in activated sludge systems. Adv. Microbiol. Ecol. 16: 169–200 Kranz R. G, Gabbert K. K, Locke T. A & Madigan M. T. (1997). Polyhydroxyalkanoate production in Rhodobacter capsulatus:genes, mutants, expression, and physiology. Appl Environ Microbiol. 63: 3003-3009 Kulaev I. S. (1983). Polyphosphate metabolism in microorganisms. Adv. Microbiol. Physiol. 24: 83-171 Kulaev I. S. (1979). The Biochemistry of Inorganic Polyphosphates, John Wiley & Sons, N. Y. Kumar A., Larsen C. E. & Preiss J. (1986). Biosynthesis of bacterial glycogen primary structure of cloning of Escherichia coli ADP-glucose: α-1,4-glucan, 4-glucosyltransferase as deduced from the nucleotide sequence of the glgA gene. J. Biol Chemistry. 261: 1625616259 Kuriyan J. & Cowburn D. (1993). Structures of SH2 and SH3 domains. Curr. Opin. Struct. Biol. 3: 828-837 Lee N., la Cour Janssen J., Aspegren H., Henze M., Nielsen P. H. & Wagner M. (2002). Population dynamics in wastewater treatment plants with enhanced biological phosphorus removal operated with and without nitrogen removal. Water Sci. Technol. 46: 163-170 94 Lee S. Y., Choi J. & Wong H. H. (1999). Recent advances in polyhydroxyalkanoate production by bacterial fermentation: mini-review. Int J Biol Macromol. 25: 31-6 Liebergesell M. & Hustede E. (1991). Formation of poly(3-hydroxyalkanoates) by phototrophic and chemolithotrophic bacteria. Arch. Microbiol. 155: 415-421 Liebergesell M. & Steinbüchel A. (1992). Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D. Eur. J. Biochem. 209: 153–160 Liebergesell M. & Steinbüchel A. (1993a). Cloning and molecular analysis of the poly(3hydroxybutyric acid) biosynthetic genes of Thiocystis violacea. Appl. Microbiol. Biotechnol. 38: 493-501 Liebergesell M., Mayer F. & Steinbüchel A. (1993b). Analysis of polyhydroxyalkanoic acid-biosynthesis genes of anoxygenic phototrophic bacteria reveals synthesis of a polyester exhibiting an unusual composition. Appl. Microbiol. Biotechnol. 40: 292-300 Liebermann L. (1890). Inorganic polyphosphate: A molecule of many functions. Pfluegers Arch. 47: 155–160 Liu W. T., Marsh T. L., Cheng H. & Forney L. J. (1997a). Characterization of microbial diversity by detrmining terminal restriction fragment length polymorphism of 16S ribosomal DNA. Appl.Env. Microbiol. 63: 4516-4522 Liu W. T., Nakamura K., Matsuo T. & Mino T. (1997b). Internal energy-based competition between polyphosphate- and glycogen-accumulating bacteria in biology phosphorus removal reactor - effect of P/C feeding ratio. Water Res. 31: 1430-1438 95 Liu W. T, Mino T., Matsuo T. & Nakamura K. (2000). Isolation, characterization and identification of polyhydroxyalkanoate-accumulationg bacteria from activated sludge. J Biosci. Bioeng. 90: 494-500 Liu W. T., Hanada S., Marsh T. L., Kamagata Y. & Nakamura K. (2002). Kineosphaera limosa gen. nov., sp. nov., a novel Gram-positive polyhydroxyalkanoate-accumulating coccus isolated from activated sludge. Int J Sys. Evo. Microbiol. 52: 1-5 Marais G. V. R., Lowenthal R. E. & Siebritz I. (1982). Proc. Post Conf. Seminar on Phosphate Removal in Biological Treatment Processes. 2: 5-6 Martin M. & Schneider D. (1997). A glgC gene essential only for the first of two spatially distinct phases of glycogen synthesis in Streptomyces coelicolor A3(2). J. Bacteriol. 179: 7784–7789 Maszenan A. M., Seviour R. J., Patel B. K., Rees G. N.& McDougall B. M. (1997). Amaricoccus gen. nov., a gram-negative coccus occurring in regular packages or tetrads, isolated from activated sludge biomass, and descriptions of Amaricoccus veronensis sp. nov., Amaricoccus tamworthensis sp. nov., Amaricoccus macauensis sp. nov., and Amaricoccus kaplicensis sp. nov. Int J Syst Bacteriol. 47:727-34 Maszenan A. M., Seviour R. J., Patel B. K. C., Schumann P., Burghardt Y., Tokiwa Y. & Stratton H. M. (2000). Three isolates of novel polyphosphate accumulating gram positive cocci, obtained from activated sludge belong to a new genus Tetrasphaera gen. nov. and description of two new species Tetrasphaera japonica sp. nov. and Tetrasphaera australiensis sp. nov. Int J. Syst. Evol. Microbiol. 50: 593-603 Mayer B. J. & Baltimore D. (1993). Signaling through SH2 and SH3 domains. Trends in Cell Biology. 3: 8-13 96 Mayer B. J., Hamaguchi M. & Hanafusa H. (1988). A novel viral oncogene with structural similarity to phospholipase C. Nature. 332: 272-275 McMahon K. D., Dojka M. A., Pace N. R., Jenking D. & Keasling J. D. (2002). Polyphosphate kinase from activated sludge performing enhanced biological phosphate removal. Appl. Env. Microbiol. 68: 4971-4978 Meyer C. R., Borra M., Igarashi R. Lin Y. S. & Springsteel M. (1999). Characterization of ADP-Glucose Pyrophosphorylase from Rhodobacter sphaeroides 2.4.1: Evidence for the involvement of Arginine in allosteric Regulation. Archives of Biochemistry and Biophysics. 372: 179–188 Michelle R. & Rondon R. (2000). Cloning the soil metagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms. Appl. Env. Microbiol. 66: 2541-2547 Mino T., Tsuzuki Y. & Matsuo T. (1987). Proc. IAWPRC Int. Conf. on biological phosphate removal from wastewater, Adv. Wat. Pollut. Cont. (Ramadori, R., ed.) Pergamon Press, Rome, pp. 27-38 Mino T., Van Loosdrecht M. C. M. & Heijnen J. J. (1998). Microbiology and biochemistry of the enhanced biological phosphate removal process. Water Res. 32: 31933207 Morton C. J. & Campbell I. D. (1994). SH3 domains. Molecular 'Velcro'. Curr. Biol. 4: 615-617 Mozo T., Dewar K., Dunn P., Ecker J. R., Fischer S., Kloska S., Lehrach H., MarrA m., Martienssen R., Meier-Ewert S. & Altmann T. (1999). A complete BAC-based physical map of the Arabidopsis thaliana genome. Nat Genet. 22: 271-275 97 Musacchio A., Gibson T., Lehto V. P. & Saraste M. (1992). SH3 - an abundant protein domain in search of a function. FEBS Lett. 307: 55-61 Nakamura K., Hiraishi A., Yoshimi Y., Kawarasaki M., Masuda, K. & Kamagata Y. (1995). Microlunatus phosphovorus gen. nov. sp. nov., a new gram-positive polyphosphate accumulating bacterium isolated from activated sludge. Int. J. Syst. Bacteriol. 45: 17-22 Nakamura S., Asakawa S., Ohmido N., Fukui K., Shimizu N. & Kawasaki S. (1997). Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library. Mol. Gen. Genet. 254: 611-620 Okita T. W., Rodriguez R. L. & Preiss J. (1981). Biosynthesis of bacterial glycogen cloning of the glycogen biosynthetic enzyme structural genes of Escherichia coli. J. Biol Chemistry. 256: 6944-6952 Palleroni N. J. (1997). Prokaryotic diversity and the importance of culturing. Antonie van Leeuwenhoek. 72: 3-19 Pawson T. & Schlessingert J. (1993). SH2 and SH3 domains. Curr. Biol. 3: 434-442 Peoples O. P & Sinskey A. J. (1989). Poly-3-hydroxybutyrate (PHB) biosynthesis in Alcaligenes eutrophus H16. Identification and characterization of the PHB polymerase gene (phbC). J Biol Chem. 264:15298-15303 Preiss J., Yung S. J. & Baecker P. A. (1983). Regulation of bacterial glycogen synthesis. Mol. Cell. Biochem. 57: 61–80 Preiss J. (1989). Physiology, biochemistry and genetics of bacterial glycogen synthesis. Adv.Microb. Physiol. 30: 183-238 98 Preiss J. & Romeo T. (1994). Molecular biology and regulatory aspects of glycogen biosynthesis in bacteria. Prog. Nucleic Acid Res. Mol. Biol. 47: 299–329 Rehm B. H. A. & Steinbuchel A. (1999). Biochemical and genetic analysis of PHA synthases and other proteins required for PHA synthesis. Int J Biol Macrobiol. Lett. 25: 3-9 Romeo G, Devoto M. & Galietta L. J. (1989). Why is the cystic fibrosis gene so frequent. Hum Genet. 84: 1-5 Sambrook J., Fritsch E. F. & Maniatis T. (1989). Molecular cloning: A Laboratory Manual (Cold spring Harbor Lab. Press Plainview, NY). Sanchez A. C. & Ilag L. L. (1999). Genetic and physical mapping of xa13, a recessive bacterial blight resistance gene in rice. Theor. Appl. Genet. 98: 1022-1028 Schembri M. A, Bayly R. C & Davies J. K. (1994). Cloning and analysis of the polyhydroxyalkanoic acid synthase gene from Acinetobacter sp.: evidence that the gene is both plasmid and chromosomally located. FEMS Microbiol Lett.118: 145-152 Schubert P., Krüger N. & Steinbüchel A. (1991). Molecular analysis of the Alcaligenes eutrophus poly(3-hydroxybutyrate) biosynthetic operon: identification of the N terminus of poly(3-hydroxybutyrate) synthase and identification of the promoter. J. Bacteriol. 173: 168–175 Seviour R. J., Maszenan A. M., Soddell J. A., Tandol V., Patel B. K. C., Kong Y. H. & Schumann P. (2000). Microbiology of the ‘G-bacteria’ in activated sludge. Env Microbio. 2: 581-593 Seviour R. J., Mino T. & Onuki M. (2003). The microbiology of biological phosphorus removal in activated sludge systems. FEMS Microbiol Rev. 27: 99-127 99 Sheu D. S., Wang Y. T. & Lee C. Y. (2000). Rapid detection of poyhydroxyalkanaoteaccumulating bacteria isolated from the environment by colony PCR. Microbiol. 146: 20192025 Sheng Y., Mancino V. & Birren B. (1990). Transformation of Escherichia coli with large DNA molecules by electroporation. Nucleic Acid Research. 23: 1990-1996 Shizuya H., Birren B, Kim U. J., Mancino V., Slepak T., Tachiiri Y. & Simon M. I. (1992). Cloning and stable maitenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad .Sci. 89: 8794-8797 Slater S. C., Voige W. H. & Dennis D. E. (1988). Cloning and expression in Escherichia coli of the Alcaligenes eutrophus H16 poly- -hydroxybutyrate biosynthesis pathway. J. Bacteriol. 170: 4431-4436 Srinath E. C., Sanstry C. A. & Pillai S. C. (1959). Rapid removal of phosphorus from sewage by activated sludge. Experientia. 15: 339–340 Steinbuchel A., Hustede E., Liebergesell M., Pieper U., Timm A. & Valentin H. (1992). Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria. FEMS Microbiol Lett. 103: 217-230 Steinbuchel A. & Valentin H. E. (1995). Diversity of bacterial polyhydroxyalkanoic acid. FEMS Microbiol. Let. 128: 219-228 Strange R. E. (1968). Bacterial “glycogen” and survival. Nature. 220: 606-606 Strong S. J., Ohta Y., Litman G. W. & Amemiya C. T. (1997). Marked improvement of PAC and BAC cloning is achived using electroelution of pulsed-field gel-separated partial digests of genome DNA. Nucleic Acids Res. 25: 3959-3961 100 Takata H., Takaha T., Okada S., Takagi M. & Imanaka T. (1997). Characterization of a gene cluster for glycogen iosynthesis and a heterotetrameric ADP-glucose pyrophosphorylase from Bacillus stearothermophilus. J. Bacteriol. 179: 4689–4698 Thomas C. M., Stalker D. M. & Helinski D. R. (1981). Replication and incompatibility properties of segments of the origin region of replication of the broad host range plasmid RK2. Mol Gen Genet. 181: 1-7 Timm A. & Steinbüchel A. (1992). Cloning and molecular analysis of the poly(3hydroxyalkanoic acid) gene locus of Pseudomonas aeruginosa PAO1. Eur. J. Biochem. 209: 15–30 Ugalde J. E., Lepek V., Uttaro A., Estrella J., Iglesias A. & Ugalde R. A. (1998). Gene organization and transcription analysis of the Agrobacterium tumefaciens glycogen (glg) operon: two transcripts for the single phosphoglucomutase gene. J Bacteriol. 180: 65576564 U. S. EPA (1987). Asbestos Hazard Emergency Response Act. 40 CFR Part 763, Subpart E – Asbestos Containing Materials in Schools. Washington, DC: U.S. Environmental Protection Agency. Uttaro A. D. & Ugalde R. A. (1994). A chromosomal cluster of genes encoding ADPglucose pyrophosphorylase, glycogen synthase and phosphoglumutase in Agrobacterium tumefaciens. Genetics. 150: 117-122 Valentin H. E. & Steinbüchel A. (1993). Cloning and characterization of the Methylobacterium extorquens polyhydroxyalkanoic-acid-synthase structural gene. Appl Microbiol Biotechnol. 39: 309-317 101 Van Veen H. & Abee T. (1994). Generation of a proton motive force by the excretion of metal-phosphate in the polyphosphate-accumulating Acinetobacter johnsonii strain 210A. J. Biol. Chem. 269: 29509–29514 Venter J. C., Smith H. O. & Hood L. (1996). A new strategy for genome sequencing. Nature. 381: 364-366 Venter J. C., Adams M. D., Sutton G. G., Kerlavage A. R., Smith H. O. & Hunkapiller M. (1998). Shotgun sequencing of the human genome. Science. 280: 1540-1542 Wagner M. & Erhart R. (1994). Development of an rRNA-targeted oligonucleiotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge. Appl. Env. Microbiol. 60: 792-800 Wang A. H., Quigley G. J., Kolpak F. J., Crawford J. L., van Boom J. H., van der Marel G., & Rich A. (1979). Molecular structure of a left-handed double helical DNA fragment at atomic resolution. Nature. 282: 680-686 Wood, H. G., and Clark, J. E. (1988). Biological aspects of inorganic polyphosphates. Ann. Rev. Biochem.57: 235-260 Yang H., Liu M. Y. & Romeo T. (1996). Coordinate genetic regulation of glycogen catabolism and bisynthesis in Escherichia Coli. Via the CsrA gene product. J. Bacteriol 178: 1012-1017 Zago A., Chugani S. & Chakrabarty A. M. (1999). Cloning and characterization of polyphosphate kinase and exopolyphosphatase genes from Pseudomonas aeruginosa 8830. Appl. Environ. Microbiol. 65: 2065-2071 102 [...]... little information of the ppk gene in organisms involved in EBPR is available 1.2 Problem Statements In the EBPR processes, the involvement of PHA, glycogen and polyP have been well documented However, the genetic information of the genes including the PHA sythase gene (phaC), glycogen biosynthesis genes (glgA and glgC), and the polyP kinase gene (ppk) involved in the metabolism of these biopolymers... dominated by a few dominant bacterial populations Still, these fingerprinting methods cannot provide information on the function of microbial communities and the functional genes involved in the EBPR metabolisms Recently, the bacterial artificial chromosome (BAC) library has emerged as a powerful tool to investigate the total genetic information in both pure and mixed culture of bacteria BAC library has been... and further investigate the genes involved in the metabolisms of PHA in EBPR systems The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor Lpha5T could accumulate significant amount of PHA without P accumulation (Liu et al., 2000; Liu et al., 2002), making it a putative GAO Specific objectives included: (1) To construct the BAC library for bacterial strain. .. 2.2.3 Genes encoding enzymes involving in PHA synthesis Genes encoding for enzymes in PHA synthesis and degradation from a number of bacteria have been identified and characterized They include phaA, phaB, phaC, phaG, phaJ, and phaZ These genes and the enzymes they encode were listed in Table 2.1 Studies (Slater et al., 1988; Peoples & Sinskey, 1989; Steinbuchel et al., 1992; Liebergesell & Steinbüchel,... map of ORF 3 68 Figure 4.15 Restriction map of ORF 4 69 Figure 4.16 Restriction map of ORF 5 69 xi LIST OF TABLES Table Page No 20 Table 2.1 Genes involved in PHA biosynthesis Table 2.2 Enzymes involved in glycogen metabolism 23 Table 2.3 Relationships between carbon metabolism and regulatory and structural properties of ADP-Glc PPase from different organisms 24 Table 2.4 Genes encoding enzymes involved. .. accumulating organisms (PAO) and glycogen accumulating non-poly-P organisms (GAO) are two major functional bacterial groups involved in EBPR processes PAO are a group of bacteria responsible for the EBPR activity Typically, in the anaerobic phase, PAO rapidly assimilate organic substrate and store them in the form of PHAs by degrading polyP into Pi to generate energy for substrate uptake and storage In the... cloned and sequenced (Rehm & Steinbuchel, 1999) Table 2.1 Genes involved in PHA biosynthesis Genes Enzymes phaA 3-ketothiolase phaB NADP-dependent acetoacetyl-CoA reductase phaC PHA synthase phaG 3-hydroxyacyl-acyl carrier protein-CoA transacylase phaJ enoyl-CoA hydratase phaZ PHA depolymerise 2.2.4 Organization of PHA biosynthesis genes The PHA biosynthesis genes and the genes encoding for other proteins... metabolism In Pseudomonas sp 61 - 3 and P aeruginosa, two different phaC genes are identified and are separated by the phaZ gene In Chromatium vinosum and Thiocystis violacea, a twocomponent PHA synthase was found (Liebergesell & Steinbüchel, 1992) with genes coding for the two components, phaC and phaE, directly linked inside an operon These results 20 Chapter 2 suggest that although genes involved in PHA... Bacterial groups involved in EBPR systems: PAO and GAO PAO are a group of bacteria responsible for the EBPR activity Typically, in the anaerobic phase, PAO rapidly assimilate organic substrate and store them in the form of PHAs through the degradation of polyP and the release of Pi In the subsequent aerobic phase, PAO take up Pi and synthesize it to polyP using stored PHAs as carbon and energy source... concentration increases in the anaerobic zone, and decreases to a level less than the influent Pi concentration in the aerobic zone At the same time, PHA levels increase in parallel with the assimilation of acetate in the anaerobic zone, and PHA levels in the biomass fall in the subsequent aerobic stage, whilst glycogen concentration decreases in the anaerobic zone and increases in the aerobic zone 2.1.2 Bacterial .. .CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb BAC library of Kineosphaera limosa. .. isolate and further investigate the genes involved in the metabolisms of PHA in EBPR systems The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor Lpha5T