Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis
... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb...
Ngày tải lên: 03/10/2015, 21:58
... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...
Ngày tải lên: 12/08/2014, 03:21
... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...
Ngày tải lên: 31/10/2012, 15:28
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... identification and quantification of puromycin were achieved by a Pac enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 ... Schematic representation of the putative biosynthetic pathway of the 3¢-amino-3¢deoxyadenosine moiety of A2 0 1A and puromycin Dpur4 mutants The results indica...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and pro...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot
... investigating the relation, differentiation and/ or maturation of monocytes, macrophages and DC have been mainly conducted in vitro using both murine and human cells [33-35] A study comparing primary ... purity of sorted cells used for the microarray experiments (PBMo, lung DC and lung Mϕ) was assessed by flow cytometry and Pappenheim-stained cytospins and w...
Ngày tải lên: 12/08/2014, 14:20
the regulation of genes involved in trichome development
... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in...
Ngày tải lên: 14/11/2014, 11:55
the regulation of genes involved in trichome development(fileminimizer)
... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in th...
Ngày tải lên: 14/11/2014, 12:16
Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells
... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in...
Ngày tải lên: 30/09/2015, 06:36
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf
... resistance regulator The Plant Journal 2009, 58:578-591 Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, Asami T, MaruyamaNakashita A, Kudo T, Shinozaki K, Yoshida S, Nakashita H: Antagonistic ... micro-arrays in the dataset The work was performed without external funding Microarray Dataset The dataset of 1436 Affymetrix Arabidopsis 25K arrays obtained from NASCArrays and AtGenExp...
Ngày tải lên: 11/08/2014, 11:20
Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx
... regulatory modules including TBPF (TATA -binding protein factors) , ECAT (enhancer of CCAAT binding factors) , or PCAT (promoter of CCAAT binding factors) p53 binding motifs were also displayed '(+)' and ... genotype and protein expression in UM-SCC cell lines p53 genotype and protein expression in UM-SCC cell lines (a) The p53 genotype of ten University o...
Ngày tải lên: 14/08/2014, 07:21
Formulate busines strategy for Dinh Vu port development and investment joint stock company in period of 2013-2018
Ngày tải lên: 27/03/2015, 14:47
Construction of business strategy in period of 2010 - 2015 of Song Da someco joint stock company
Ngày tải lên: 27/03/2015, 14:49
Higher education and the construction of institutional identities in a globalising world
... Kong and Singapore, and finally taking hold powerfully in mainland China and India – has altered the balance of power in the global economy and hence in geopolitics The rising nations of the East ... between a global brand like Coca Cola and Levi’s and being ‘global’ as a brand In both instances, these arise out of the processes of globalization In...
Ngày tải lên: 11/09/2015, 10:01
Báo cáo khoa học: Therapeutic targeting of molecules involved in leukocyte–endothelial cell interactions potx
... transcriptional induction and redistribution from intracellular pools [20] Integrins mediate cell cell, cell extracellular matrix and cell pathogen interactions by binding to distinct, but overlapping, ... al Targeting leukocyte–endothelial cell interactions Fig Cell surface molecules as potential targets in inflammatory bowel disease as a lymphocyte-driven disease Selectins...
Ngày tải lên: 07/03/2014, 12:20