... for you).–SIMILARITIES AND DIFFERENCES: COMPAREAND CONTRAST –72■As you go through your day, compareandcontrast things around you. Compareand contrast, for exam-ple, your current job ... (a compareandcontrast essay might tell youwhich car is better) or which savings bond to invest in(a compareandcontrast essay will show you whichbond is best for you).–SIMILARITIES AND ... dimple.LESSONSimilarities and Differences: Compare and Contrast LESSON SUMMARYThis lesson explores another organizational pattern writers often use to structure their writing: comparison and contrast. 867...
... strands of regulatoryscholarship, by bringing to the fore the political and constitutional context inwhich regulation is embedded. By political and constitutional context, we meanthe social structures ... timely textbook provides a conceptual map of the field and an accessible and critical introduction to the subject. Morgan and Yeung set out a diverse and stimulating selection of materials and give ... Introduction to Law and Regulation Text and MaterialsBronwen Morgan and Karen Yeung segments of society. Laws of this sort are a product of deliberative processes on thepart of citizens and representatives....
... the properties and methods discussed thus far, text fields have numerous unique methods and properties for manipulating and controlling text within the text field (rather than the text field itself, ... is set to autosize text as it's entered), displays the text Enter text here. Notice that movingField_txt has been set up as an input text field and can wrap lines of text. It's the ... properties of text field instances: ã autoSize. This property determines whether a text field expands and contracts its borders automatically to accommodate the amount of text it contains. A text field's...
... principal structure models developed by Leland and Toft (1996), Leland (1998), and others. These papers take the form of the securities as given and derive the effect of capital structure on ... an expanded version of Table I. We do not include a row for λ, but it is easy to see that λ and σ have the same effects on W0, W*, and b(W*), and the effect of λ on CL and D ... deal about how the optimal capital structure is determined by the specific features of the project. Also, termination is needed, and thus the credit line expands and debt shrinks). Though not visible...
... default th an borro w at excessiv e ly lowprices.We now compare the model and d ata in terms of price and spread dynam ics. The spread and price series for the data are for 2- an d 10-year bonds ... present the model’s short and long spreads, and the fifth and sixth columns present the data counterpar ts. In the model when default is un likely, bothspreads are low, and the spread curve is ... a , and Rios-R ull (200 7) a ndLivshits, MacGee, and Tertilt (2007)). Howe ver, it wo uld be interesting to analyze both l ong-term and short-term defaultable loans, suc h as m ortgages and...
... Kidney (A and B) and skeletal muscle (C and D)from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum. In the control, basement membranes throughout the kidney and skeletal ... 549±559.Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 441 Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modiđcation and immunochemical analysis of tissuecontentsTakako ... Germany). T he sense and antisenseprimers for b1 were GTCAGCTAGCTAACGAGGTGGAGTCCGGTTAC and GTCACTCGAGCTAAAGGCCCGTCTGGTGAATCAAG, respectively, and for b2GTCAGCTAGCCCGTCCCTGTGACTGTGATG and GTCACTCGAGCTAGGCTTGACAGCCTGCAGGG,respectively....
... 96Information, Innovation, and the Structure of Agriculture, 97 Structure and Coordination, 97Intellectual Property Rights and Distributional Consequences, 99Global R&D and Information, 101 ... mitigation and management strategiesof buyers and suppliers, strategic positioning and market power or controlstrategies of individual businesses, and private-sector research and development and technology ... policies; and knowledge and information, including the increased privatization and globalization ofinformation and research and development markets—have particularlysignificant structural effects, and...
... withMOLSCRIPT[31] and RASTER3D[32]. The co-ordinates andstructure factors are deposited inthe Protein Data Bank under accession code 1H3G.Results and discussionDNA and polypeptide sequenceThe ... transglycosylation activity [16]. The sequence and 3D structure of the enzyme is presented and comparedwith related proteins.Experimental proceduresIsolation and sequencing of the geneThe enzyme was ... respectively. The a-helices and b-strands are given for reference. Helices a1 through a14 and strands b9throughb16comprise the TIM barrel. Domain B is inserted between b11 and a6. The seven 310-helices...
... prom-inent bands employing the Weber and Osborn proto-col. In this study on D. magna Hb subunits, threebands were found using the Laemmli protocol and only a single band with the Weber and Osborn ... post-translational and postfolding event, which affects the structure of a protein by determining the secondary, ter-tiary and quaternary structure (aggregation, multimeri-zation) and occurs only ... molluscs and crusta-ceans up to the giant annelid and vestimentiferanhemoglobins of about 3600 kDa, which are composedof globin and nonglobin subunits [1].Specifically, the structureand function...
... procedures.M, D and T denote monomer, dimer and tetramer, respectively.(A) Two peaks were observed for intact PC at 13.76 and 17.02 min,which correspond to the tetramer and monomer, respectively, and theelution ... PC-(CT + BCCP), two peaks, major and minor, wereobserved at 17.17 min and 18.82 min (Fig. 4B) and theapparent molecular masses estimated from them were128.2 ± 1.8 kDa and 66.2 ± 1.1 kDa, which appearedto ... kDa) and thyroglobulin (669 kDa). Elution times of intact PC and engineered proteins are represented by d, as labelled.Fig. 2. SDS/PAGE (A) and avidin-blot analysis (B) of purified intactPC and...
... Comparison andContrast In Both A'sWorn By Hester and DimmesdaleThe two A's worn in the novel by both Hester and Dimmesdale aredramaticallydifferent, yet they are born and made by ... personal interpretation and individualconsequences. Where one character's beauty and open mindedness toher crime and punishment makesher A and her punishment (Pearl)natural and beautiful. While ... changingemotional state and physical well being of thecharacter, the towns viewsof morality and natural order, and the affecting environment. The twosins of most importance in the novel and that serve...
... Credibility, and Disin‡ation in a Small Macroeconomic Model. Journal of Economics and Business, 52, 51–86.King, R.G. –Kurmann, A. (2002) Expectations and the Term Structure of Interest Rates: Evidence and ... and the interest rate dynamics isalso explained by the existence of this asymmetric information set betweenprivate agents and monetary authorities. Hence, Huh and Lansing (2000) and Erceg and ... in‡ation target and long terminterest ratesEvans and Lewis (1995) and Crowder and HoÔman (1996) have shown thatthe Fisherian decomposition of a nominal rate into the expected real rate and expected...
... appearance of words and phrases, and their correspondin~ meaning structures. 159 Scruffy Text Understanding: Design and Implementation of 'Tolerant' Understanders Richard H. Granger ... of texts like [i], that allow readers to unaerstand it in spite of its scruffiness; and some of the knowledge and mechanisms that seem to underlle readers" ability to understand such texts. ... of text understanding is the com- bined applicatlon of these knowledge sources as a reader proceeds through a text. This fact becomes clearest when we investigate the understanding of texts...