0

command s can be used to discover details about a neighboring router without logging in

Tài liệu CCNA Exam Certification Guide ppt

Tài liệu CCNA Exam Certification Guide ppt

Chứng chỉ quốc tế

... extended access lists; SAP access lists; monitoring IPX access lists; AppleTalk packet access lists; AppleTalk zone access lists; monitoring AppleTalk access lists Introduction to Serial Connections ... lists, TCP/IP access lists; wildcard masks; configuring standard IP access lists; configuring extended access lists; monitoring IP access lists; configuring IPX standard access lists; configuring ... is used by Cisco routers and switches to ascertain basic information about neighboring routers and switches You can use this information to learn addresses quickly for easier Simple Network Management...
  • 638
  • 6,444
  • 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học

... XhoI and AatII; D3, AatII and AvrII PCR using Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and add adenine nucleotide overhangs before ligating ... expressed as specific activity, and kcat is calculated from Vmax using molecular mass and a conversion from minutes to seconds Errors of mean values for each parameter were determined as the standard ... TSAC, it is reasonable to speculate that closing of one active site is structurally linked to substrate binding in the second Stated another way, formation of the TSAC in one active site may act...
  • 9
  • 567
  • 0
THE ROLE OF THE FINANCIAL SERVICES SECTOR IN EXPANDING ECONOMIC OPPORTUNITY potx

THE ROLE OF THE FINANCIAL SERVICES SECTOR IN EXPANDING ECONOMIC OPPORTUNITY potx

Ngân hàng - Tín dụng

... Access to financial services Financial services firms aim to increase availability and affordability of banking and savings accounts The major banking players have already gained significant traction ... reason, across industries, is for business to leverage its own comparative advantage in society As Milton Friedman might say, “the business of business is business” – and this is exactly what ... developers/financiers Unlike traditional financial risk assessments done by banks, GroFin specialists assess applicants on the basis of the entrepreneurs’ credibility and business plans rather than...
  • 48
  • 837
  • 0
Effects of the three obediences and four virtues ethics on vietnamese women in the present time

Effects of the three obediences and four virtues ethics on vietnamese women in the present time

Tổng hợp

... the activities of propaganda, and dissemination for all staffs, members of the Communist Party, and masses about women s role and position in all the society as well as in families, contributing ... CONCLUSION Confucianism appeared as an ideology in China in the Spring – Autumn and the Warring States period and was introduced into many Asian countries, including Vietnam Confucianism is an ethical ... propagation and dissemination to all staffs, members, and the masses about women s important roles and positions in all social fields as well as in the domestic family, thereby contributing to rapidly powerful...
  • 29
  • 910
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

Y học thưởng thức

... analysis with Fisher 's exact test using MS Windows Statview (Abacus Concepts, Berkeley, CA, USA) P < 0.05 was considered statistically significant Results In September 2000 a MET system was introduced ... period and related this to aspects of nursing and medical daily routine Materials and methods The hospital Austin Health is a university-affiliated teaching hospital with three hospital campuses situated ... pulse oximetry (
  • 4
  • 541
  • 0
Báo cáo y học:

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

Y học thưởng thức

... patients attended the clinic again and it is the lipid values and biometric data obtained at this visit which were used for statistical analysis in this study The presence of chd was assessed by ... using the ‫ ²א‬test The data was analysed using SPSS 12.0 software The association between the +294T/C polymorphism and serum lipids, coronary heart disease, and body mass index (BMI) was calculated ... have shown that the PPARδ T+294C SNP is associated with elevated plasma LDL cholesterol and apoB levels in men and we show in this work that similar associations are operating in women, we also...
  • 4
  • 568
  • 0
Báo cáo y học:

Báo cáo y học: "Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects"

Y học thưởng thức

... studies, Pearson correlation test was used P value of < 0.05 was considered statistically significant Statistical analysis was performed using SPSS 10 statistical Package Results The results of some ... Omenn GS, Motulsky AG A quantitative assessment of plasma homocysteine as a risk factor for vascular disease: Probable benefits of increasing folic acid intakes JAMA 1994;274(13):1049-57 Ubbink ... were analysed statistically Statistical analysis of the data analysis was carried out using the ANOVA test Prevalence of alleles and genotype among cases and control subjects were counted and...
  • 12
  • 519
  • 0
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

Thạc sĩ - Cao học

... Northwest Airlines 35 Pakistan International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas The Spirit of Australia 39 Singapore Airlines Singapore Singapore Girl, you're a great way to fly The USA ... advertising copywriter The Language of Airlines’ Advertising Slogans Page 14 Business Advertising Business advertising is often said to be invisible, because unless one is actively involved in some ... study Chapter is called MAIN FINDINGS AND DISCUSSIONS, in which the author summarizes her findings in the characteristics of the English language used in airlines’ advertising slogans and also...
  • 45
  • 1,380
  • 10
REVIEW OF THE FISHERIES SUPPLY CHAIN  IN VIET NAM

REVIEW OF THE FISHERIES SUPPLY CHAIN IN VIET NAM

Kinh tế - Thương mại

... demands during the main fishing seasons, most boats fish similar species at the same time, same fishing ground In that case, due to poor facilities for storing, the marine fishing products can ... parties (retailers, small scale traders, supermarkets, agents, restaurants, ) may also be lost in the trading However, the main reason is that they lack experiences in bussiness or poor skills ... capacity for associations related in the supply chain of marine fisheries Currently, there are various relevant associations such as VINAFIS, VASEP,… and in the future some new associations may...
  • 46
  • 562
  • 0
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM

DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM

Kinh tế - Thương mại

... and weakness Sales, sales growth and profitability are major measurements of business performance and past strategy The analysis covers resources, capability that is vital to build and sustain ... business and domestic sales As discuss earlier, revenue from FOB business is twice as much as that of from commission business FOB and domestic sales represents very high percentage in company ... software is also needed Besides, marketing information system software is also needed to monitor and restore sales figure overtime This information can be used again in future planning and developing...
  • 75
  • 920
  • 4
Negotiating agrarian change livelihood agriculations of the commercial craft peasantry in northern vietnam

Negotiating agrarian change livelihood agriculations of the commercial craft peasantry in northern vietnam

Thạc sĩ - Cao học

... both classical and some current theorists have been trapped in dichotomous thinking regarding the relationships between peasants and non-peasants, as well as between farming and off-farming activities ... other hand, he emphasizes states’ roles in maintaining small subsistence farming, in the context of commercialization and industrialization According to Rigg (2002) small subsistence farming has persisted ... lifestyles of those who choose to maintain small-scale farming activities It can be asserted that state policies, market forces and culture, have been intertwined in shaping the fate of the peasantry,...
  • 347
  • 483
  • 0
Simulation of the thermal borehole resistance in groundwater filled borehole heat exchanger using CFD technique

Simulation of the thermal borehole resistance in groundwater filled borehole heat exchanger using CFD technique

Môi trường

... un-radial pattern is seen inside the borehole due to both U-pipe legs acting as heat sources The heat transfer becomes radial after a distance out in the bedrock (rradial) This un-radial heat flow in ... It is clearly seen here that Mu and Mer result in almost the same values for all modelling approximations and boundary conditions It is also seen that THT results in almost the same value independent ... is transferred far out in the bedrock Using a constant heat flux instead results in a higher temperature in the middle of the borehole as a result of twice as much heat input in this area giving...
  • 12
  • 371
  • 0
The conservatism of the early English colonists in North

The conservatism of the early English colonists in North

Kỹ năng đọc tiếng Anh

... photography of snowflakes are not usually found in actual snowfalls Typically, snowflakes in actual snowfall consists of broken fragments and clusters of adhering ice crystals For a snowfall to ... economics and social potential of this Parisian housing form But the Stuyvesant was at best a limited success In spite of Hunt s inviting façade, the living space was awkwardly arranged Those who ... places (C) To suggest that fossils found in both places were the same age (D) To explain why scientists are especially interested in Canadian fossils 28 The word “it” in line 24 refers to (A) ...
  • 12
  • 1,572
  • 7
A contrastive study of connotation of the vietnamese zodiac animals in english and vietnamese idioms and proverbs

A contrastive study of connotation of the vietnamese zodiac animals in english and vietnamese idioms and proverbs

Kinh tế

... similarities may result from: (1) similar features and meaning in Vietnamese VZAs are used to maximize personal impact characteristics of VZAs, (2) similarities in social activities, feelings, ... English and proverbial phrases relating to VZAs correctly in everyday and Vietnamese Similar connotations are related to such animals as situations As the whole, teachers can encourage their students ... endearments and perhaps more frequently, in insults The data English examples: Cat in gloves catches no mice, Rain cats analysis in English and Vietnamese idioms and proverbs has proved and dogs...
  • 13
  • 1,139
  • 4
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese

A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese

Khoa học xã hội

... gain a better insight into various aspects about WDBs 1.3.2 Objectives: This research is planned to: - Describe the semantic and pragmatic features of the WDBs in English and Vietnamese - Analyse ... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic ... contexts as “the parts of an Data is described, classified, and analyzed systematically for utterance next to or near a linguistic unit (such as a word) which is the contrastive analysis the focus of...
  • 13
  • 1,702
  • 5
Tài liệu Final Report

Tài liệu Final Report "Evaluation of time management skill of the 3rd year students in FFL - HUT" pptx

Báo cáo khoa học

... 3rd year students are focused on as they have already had to study ESP with a large amount of difficult assignments This stage of learning is the beginning of hard-working If they fail to manage ... Students are required to prepare for the lesson by reading the passages, doing homework and tasks that their teachers ask them to  Students are expected to find their materials related to each ... their answers After being designed, this questionnaire was tested out on a scale of 15 students in one class, and pre-coded questions need to be improved Then, a sample of 40 students was selected...
  • 11
  • 687
  • 1
An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

Khoa học xã hội

... cyclical basis What makes action research suitable for this study is because of the following reasons Firstly, to investigate this study I myself must practice teaching in real classes and get ... acceptance because research has indicated its theoretical vadility and teachers have discovered its pedagogical effectiveness Instructors of both reading and writing have in many cases already begun to ... English the gist of what they have read The reading materials may be served as a basis for oral presentations, some may be dramatized in role-plays and some may provide a setting for discussions...
  • 90
  • 576
  • 1
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Sức khỏe giới tính

... having, in fact, sensibly affected the after health A careful analysis of these cases seems to me to shew that if harm really was done by too great a strain being laid upon the system in early life, ... sacrifice themselves annually on the altars of our popular pastimes, exist rather in the timid brains of alarmists than in the stern tables of statistical investigation Having thus discussed the different ... years ago." Another of his fellow-oarsmen says: " D was a very fine oar, but he always gave me the idea of being an unsound man ; he was always pallid, and looked ghastly after a long and severe...
  • 419
  • 541
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Báo cáo khoa học

... GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA ... CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG ... factors t-bet, stat6 and foxp3 S Mitra et al XENOPUSLA STAT1 CHICKEN STAT1 MOUSE STAT1 PIG STAT1 HUMAN STAT1 SALMON STAT1 TETRAODON STAT1 HALIBUT STAT1 SNAKEHEAD STAT1 CHICKEN STAT4 MOUSE STAT4...
  • 20
  • 689
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008