chemistry changes in salinity and decrease in lime as a result of 1 drilling salts su
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... the lines seen in the UK and US and to a lesser extent in Canada 9 .1 Decline of the welfare state Teeple [11 ] sees increasing income and wealth inequalities and the weakening of social infrastructures ... associated costs, and the increasing perception of health as a business All of these have contributed towards increasing privatisation of health care services in general and in home care in particular ... entire population (poverty rates) in Canada and four comparison nations, 19 94 Canada Denmark Sweden UK US Table Active and passive labour market public spending, as percentage of GDP Canada and four...
- 17
- 843
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... high activity of GNRH1 (Figure 2B and 4B) was found This activity was 10 higher than in other cases which may indicate patients in metastasis stage Analysis of results demonstrated that in part of ... (Table 3) as well as clinical data (Table 4) in studied tissues and blood was observed Discussion The critical role of circulating tumor cells in metastatic spread of carcinomas has already been ... H: Evaluation of parametrial spread in endometrial carcinoma Obstet Gynecol 2 010 , 11 6 :10 27 -10 34 17 Chiang AC, Massagué J: Molecular basis of metastasis N Engl J Med 2008, 359:2 814 -2823 18 Gerges...
- 9
- 460
- 0
báo cáo hóa học: " F-fluoride PET: changes in uptake as a method to assess response in bone metastases from castrate-resistant prostate cancer patients treated with 223Ra-chloride (Alpharadin)" pdf
... Mean SUVmax, PSA and ALP changes at and 12 weeks as a percentage of baseline levels in the five subjects (A to E) A potential weakness of an indirect assessment of tumour activity by measuring ... measured metastatic sites and changes in mean SUVmax, PSA and ALP at and 12 weeks after first administration of 223Ra Subject (disease extent) weeks Measured sites weeks 12 weeks Mean SUVmax ... Methods This imaging study was performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases and castration-resistant prostate cancer Repeated 18 F-fluoride...
- 6
- 286
- 0
Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx
... enzymatic activity for the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, and sorbitol dehydrogenase Additional ... Issue 6, Article R100 Lobenhofer et al R100 .11 Cycle Target Labeling kit (Affymetrix, Inc., Santa Clara, CA, USA) following the manufacturer's protocol The amount and quality of the cRNA was assessed ... Centrilobular Thioacetamide 15 50 NA 15 0 PBS Oral gavage Centrilobular Galactosamine 25 10 0 NA 400 PBS Intra-peritoneal injection Random *1, 4-Dichlorobenzene was intended to function as a non-toxic analog...
- 13
- 284
- 0
Elders engaged in begging as a means of livelihood in debre birhan town an exploration of major push factors and their challenges
... were disabled and that are participating in begging as a means of livelihood in different parts of Addis Ababa city Cultural factor Cultural attitudes towards begging may also be a factor in the ... Zakat and Christian’s Miswat are some of the examples According to Jelili and Mnitp ( 2 013 ) the issue of alms giving and begging as obtained in the scriptures of both Islam and Christianity In ... livelihoods and survival strategies among migrant children revealed that elders as well as street children, disabled people, and families beg in public spaces such as shopping areas, cinema and theater...
- 91
- 299
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG ... nonspecific deacetylase inhibitor trichostatin A (TSA) resulted in the appearance of a significant amount of acetylated tubulin (Fig 1C, and h; Fig 1D), indicating that both acetylase and deacetylase were ... GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 835 81 83552 914 89– 915 17 924 31 92404 78772–78800 79 013 –789 81 210 –237 657–6 31 705–728...
- 14
- 416
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005 ,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... sretemaraP )DS ± naem ,6 = n( stibbar elirbef dna yhtlaeh ot noitartsinimda ralucsumartni retfa emipefec fo sretemarap citenikocamrahP elbaT la te haduoG namyA 4 51 .15 2-642 , 912 ,07 91 loisyhP J mA ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
- 5
- 205
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... 10 -14 10 -13 10 -12 10 -11 10 -11 10 -11 10 -11 10 -11 10 -10 10 -10 10 -10 10 -10 10 -9 10 -8 10 -8 10 -7 10 -7 10 -2 10 -13 10 -12 10 -11 10 -13 10 -12 10 -9 10 -10 10 -10 10 -10 10 -7 10 -9 10 -8 10 -7 10 -7 10 -5 10 -8 10 -8 ... 2,3,5-trimethylpyrazine 2,6-dimethylpyrazine 10 -12 10 -11 10 -11 10 -11 10 -11 10 -10 10 -9 10 -9 10 -12 10 -12 10 -12 10 -8 10 -9 10 -6 10 -12 10 -9 10 -11 10 -12 10 -9 10 -9 10 -7 √ √ √ √ √ √ √ √ PHENOLS, INDOLES, OTHERS Indole ... 10 -8 10 -1 10 -15 10 -13 10 -12 10 -11 10 -11 10 -11 10 -10 10 -9 10 -10 10 -10 10 -9 10 -8 10 -9 10 -7 10 -7 10 -6 10 -6 10 -2 √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ 1Compiled from References 13 1, 13 2, and 13 5 =...
- 17
- 733
- 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc
... (I in pig and human; L in rat), 680 (L in pig and human; I in rat), 760 (K in pig; R in rat and human), 9 91 (A in pig and human; S in rat), 10 09 (M in pig and human; R in rat) and 10 23 (L in ... described in Materials and methods TRH-degrading Lectin Brain enzyme Serum enzyme Liver enzyme SNA (Sambucus nigra A. ) GNA (Galanthus nivalis A. ) MAA (Maackia amurensis A. ) DSA (Datura stramonium A. ) ... under reducing conditions a molecular mass of 12 5 000 Da was estimated for the liver enzyme and the serum enzyme and a molecular mass of 11 6 000 Da for the brain enzyme, indicating that all these...
- 9
- 477
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 306
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 282
- 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx
... skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed by pressure bandaging Case ... past tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis Conclusions Vulval elephantiasis is very rare, and vulval elephantiasis as a consequence of ... manifests as soft-pitting edema In the second stage, there is an accumulation of fibroblasts, adipocytes and macrophages in the affected tissues, culminating in a local inflammatory response This results...
- 5
- 457
- 0
the subsidy regulations and vietnam’s position as a member of the wto
... on the export of sugar cane between Australia, Brazil, and Thailand and the EC55 and between Brazil, Australia, Canada, China, India, Thailand and Japan and the US in the cotton case.56 WT/DS267 ... Law of International Trade in Agriculture, 2003, P160 -16 5 22 The Canada – Dairy, report of the Panel, supra n 19 , para 4. 310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 18 ... Countervailing Measure(s) World Trade Organization United State Executive Summary Supporting subsidies and fighting against subsidies in international trade are usually argued for at the same time...
- 59
- 314
- 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf
... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... 2004 In each map was classified into 11 categories of land use/land cover types Land covers 19 99 Land covers 2004 Intensive of changed areas 11 19 99 land use classes 2004 Km2 % Km2 % Dark evergreen ... and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack of an appropriate tool...
- 24
- 897
- 0
Báo cáo hóa học: " Treatment combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of mice" doc
... of combination therapy in cancer that include RU486 as an adjuvant and merits consideration for testing in human clinical trials 10 11 Acknowledgements This paper is dedicated to the memory of ... rhythm as a predictor of breast cancer survival J Natl Cancer Inst 2000, 92:994 -10 00 Gabaglia et al Journal of Translational Medicine 2 010 , 8:98 http://www.translational-medicine.com/content/8 /1/ 98 ... 2008, 10 1 :10 84 -10 89 doi :10 .11 86 /14 79-5876-8-98 Cite this article as: Gabaglia et al.: Treatment combining RU486 and Ad5IL -12 vector attenuates the growth of experimentally formed prostate tumors and...
- 10
- 773
- 0
Báo cáo sinh học: " Impact of changes in diet on the availability of land, energy demand and greenhouse gas emissions of agriculture" pot
... animals and monogastric animals This calculation yielded the area of arable land and grassland needed for animal feed production [47] The starting point of each scenario is a change in diet among ... the area of land made available due to decreased meat production It was assumed that where arable land and grassland are released due to falls in livestock production, this occurs evenly all ... requirements of the national bioethanol plant, a maize wheat ratio of 1: 1 is assumed As a result, based on average yields, 52,000 of wheat and 25,000 of maize would be needed to meet the demand Results...
- 27
- 553
- 0
Báo cáo toán học: " Impact of changes in diet on the availability of land, energy demand, and greenhouse gas emissions of agriculture" docx
... wheat ratio of 1: 1 is assumed As a result, based on average yields, 52,000 of wheat and 25,000 of maize would be needed to meet the demand Results Because the baseline situation and scenario results ... Environ 11 8:6–28 doi :10 .10 16/j.agee.2006.06.006 Fazeni and Steinmüller Energy, Sustainability and Society 2 011 , 1: 6 http://www.energsustainsoc.com/content /1/ 1/6 10 11 12 13 14 15 16 17 18 19 20 21 ... production in Austria currently Arable land and grassland available for renewable energy feedstock production in Austria Baseline situation in 2006 Estimated potential in 2020 for a national Biomass Action...
- 14
- 457
- 0
Báo cáo lâm nghiệp:"Growth and biomass partitioning of Fagus sylvatica L. and Quercus robur L. seedlings in response to shading and small changes in the R/FR-ratio of radiation" pot
... biomass with increasing light intensity was found by Cornelissen [12 ] for Castanopsis fargesii and by Wiebel et al [53] for Garcinia mangostana In addition, an increasing number of branches of ... species (variable Z1) and between the control and the two shade treatments (variable Z2) (table I) Branch dry mass of beech was higher than that of oak (negative value of variable Z1), whereas leaf ... species and treatment effects Statistical analyses was done by using the REG procedure of SAS® (Statistical Analysis System 6 .12 , SAS Institute Inc., Cary, N.C.) RESULTS 3 .1 Total yield after 13 5 days...
- 9
- 341
- 0
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... ratio of COL 1A1 /COL 1A2 Relative polymerase chain reaction product/GAPDH ratios for alkaline phosphatase (ALP), osteocalcin (OCN), and osteopontin (OPN) and the relative ratio of COL 1A1 /COL 1A2 mRNA ... AGCCGTGGGAAGGACAGTTATG Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG Antisense CCTGTCTCCACACACGAACTG IGF-II Sense GAGGAGTGCTGTTTCCGCAG Antisense ACGTTTGGCCTCCCTGAACG TGF- 1 [53] ... disease [6 ,15 ,17 ,18 ,24,32] The results of this study indicated significant elevation in the OB markers, OCN and ALP, as well as OPN and the alpha chains of collagen type I, COL 1A1 and COL 1A2 ,...
- 12
- 421
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu