... M NH40Ac at pH and 85 C (bound to organic matter) extractions and concentrated nitric, Chromium speciation in municipalsolidwaste 19 perchloric and hydrochloric acid digestion (residue fraction) ... metal concentrations at a < 0.05 process had a statistically Total metal concentration In ascertaining the concentration of total metal content in the compost (which could be used as a reference ... leach from the waste under certain condition such as acidic rain, or saline wastewater irrigation Chromium cd Cr speciation in municipal Cu’ solidwaste NI 23 al Metal Metal Figure Comparison...
... WP and blend coal (BC) derived from coking process with byproducts recovery technology, and incineration ash melting technology by electrical arc furnace (EAF-IAM) for MW coming from flame furnace ... with BC; and the resulting coke, tar and COG could be disposed and recycled through conventional coking process directly Co-coking technology for WP and BC shows four features as following: (1) ... Additional equipments are just equipments for sorting, crushing, mixing and forming which enormously reducing original investment and operation expense with simple craftwork and short construction cycle...
... by incineration and/ or landfill However, environmental concerns about both options demand implementing alternative solidwaste solutions Public concerns on air pollution from incineration have ... encouraged to contact the authors directly The Potential of Cellulosic Ethanol Production from Municipalsolid waste: A Technical and Economic Evaluation Jian Shi, Mirvat Ebrik, Bin Yang*, and ... halted construction projects of many new incinerators In addition, the government, in reaction to problems associated with landfills, has mandated recycling to conserve natural resources and arrest...
... waste generation andwaste collection in some big cities o f Vietnam [9] Table 2: MSW generation and collection rate in cities/towns in Vietnam No Name o f city/town Generated amount m Collected ... and controlling environment impact during producing process is still challenges for developing country such as Vietnam 1.1.3 Energy consumption in Vietnam Vietnam is one o f the best performing ... Collection and treatment MSW collection rates and efficiency vary from one area to the next depending on the size o f the city, the distance to the urban center and the type o f collection service Hanoi,...
... composting then and incinerating - Incinerating; Aerobic composting then and incinerating - Incinerating; Aerobic composting then and incinerating - Incinerating; Aerobic biological landfilling biological ... Incinerating; Aerobic composting then and incinerating - Incinerating; Aerobic composting then and incinerating landfilling biological landfilling biological landfilling biological landfilling Figure ... economic sectors, community participation in solidwaste management and environmental protection; - Incentives mechanism and policies to invest in environmental projects, infrastructure projects;...
... eukaryotic expression vector pEGFP -N1 (Clontech, Mountain View, CA, USA) Cell culture, transfection and lysate preparation Cos-1, 293T and HeLa cells were maintained at 37 Cand 5% CO2 in Dulbecco’s ... In the present study, we confirmed activation of JNK and its downstream transcription factor c- JUN by JSP1, which was dependent on a functional myristoylation site Since myristoylation-deficient ... expressing JSP1-G2A or -CS, or to those transfected cells expressing JSP1-wt that remained attached to the culture dish Since the detachment of cells and condensation of chromatin also occurs during...
... condition (C) Distribution of total glutathione in the intracellular and extracellular compartments: HepG2 cells were incubated for h under normoxic and hypoxic conditions in the absence and presence ... glucose under normoxic and hypoxic conditions After NMR analysis, the peaks corresponding to [1 3C3 ]glutamine (Gln) and ⁄ or [1 3C3 ]GSH (c- glutamyl), [1 3C4 ]GSH (c- glutamyl), and [1 3C2 ]glutamine and ... glutathione transferase [15] in cancer cells Such alterations of the glutathione system can enhance survival of cancer cells In general, hypoxia and reoxygenation may induce important modifications...
... disulphide bond between cysteine residues [18] The role of PrPC in cell function is not known, but it has been associated with synaptic, enzymatic and signaling functions, copper binding and transport ... of PrPC in consideration of the di-, mono- and nonglycosylated protein bands For distinct discrimination among various species, such as mouse, sheep, cattle and humans, C- terminal binding antibodies ... region (N- terminal region) Intermediary region (N- terminal region) Intermediary region (N- terminal region) Central region (C- terminal region) Central region (C- terminal region) Central region (C- terminal...
... muscle contraction [10] TnC interacts with both TnI and TnT The TnC–TnI interaction and changes in the interaction upon Ca2+ binding to TnC have been intensively studied as the central mechanisms ... TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ATnI232F ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
... also consistent with a coordinated up or down regulation of the nuclear and mitochondrial genes under various physiological and pathological conditions such as cardiac growth, development and cardiac ... grant GM49683 References Taanman, J.W (1997) Human cytochrome c oxidase: structure, function, and deficiency J Bioenerg Biomemb 29, 151–163 Capaldi, R.A (1990) Structure and function of cytochrome ... mitochondrial and nuclear genome encoded CytOX mRNAs are uniformly down regulated during hypoxia Results also show changes in the composition and activity of the enzyme complex, which is accompanied by...
... functional cooperation of Dnmt1 with Dnmt3a and Dnmt3b in maintenance as well as in de novo methylation of DNA [34] In this work it was shown using Dnmt1, Dnmt3a and Dnmt3b knock-out cell lines ... methylation also has been concluded from studies with cell lines which not express functional Dnmt1 [36] and, finally, a functional interdependence of the Dnmt3a and Dnmt3b enzymes has been demonstrated ... of DNA methylation in mammalian epigenetics Science 293, 1068–1070 Jeltsch, A (2002) Beyond Watson and Crick: DNA methylation and molecular enzymology of DNA methyltransferases Chembiochem, in...
... I O N This page intentionally left blank L RANDEOM WALK IN RANDOM ANDN NON RANDOM N M ENVIRONMENTS ENVIRO E C O N EDITION D Pal Revesz Technische Universitat Wien, Austria Technical University ... 33.2 Non-nearest-neighbour random walk 33.3 RWIRE in Z d 33.4 Non-independent environments 33.5 Random walk in random scenery 33.6 Random environment and random scenery ... thereof; may not be reproduced in any form or by any means, electronic or mechanical, including photocopying, recording or any information storage and retrieval system now known or to be invented, without...
... with N- and C- terminal protein fragments of hEAG1 we could not detect interaction, neither alone nor in the presence of CaM (not shown) In addition, peptides encoding the N- and C- terminal binding ... consisting of six transmembrane segments and extended cytosolic N- and C- terminal domains Functional channels are formed by of such subunits involving the C- terminal assembly domain (C) Magnified sections ... constants KD for binding of TMR-MCGS(H)6-hCaM to the indicated constructs in the absence and presence of 25 lM free Ca2+ determined by confocal FCS ND ¼ not determined KD (nM+) Constructs Short name...
... pregnancy The cDNA encoding the hcCTL III was expressed in Escherichia coli and the recombinant protein (shown in 1227 C- type lectins in the male seahorse pregnancy P Melamed et al A B Fig Three novel ... synthase F0 subunit [P olivaceus] (4e-25) CV864030 CV864031 CV864032 Lectin C- type domain containing protein [C elegans] (5e-07) C- type lectin [A japonica] (4e-16) Leucine-rich repeat-containing ... et al C- type lectins in the male seahorse pregnancy Table Identified cDNA clones from male seahorse brood pouch, based on gene and ⁄ or protein comparisons Clone Gene Protein Accession number...
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of site directed ... 2-2007) and Consejo de Investigaciones Cientificas y Tecnicas (CONICET) (PIP 00237) NZW and HAV are doctoral fellows from CONICET MVB and DGC are research members from CONICET References Smith ... any protein band, indicating that the interaction is speci c Controls using pre-immune serum were consistently negative (not shown) Furthermore, the interaction between D123 and CD was confirmed...
... shown contains the entire a3 helix and the latter does not contain it Overproduction and purification Upon induction for overproduction at 10 C, N- domain+ and C- domain+ accumulated in the cells ... proteins are composed of N- and C- domains, which are spanned by a 40 amino acid long a3 helix The N- domain consists of a1 and a2 helices and an N- terminal region of a3 helix The C- domain consists ... the intact protein in Fig Because a long a3 helix spans both the N- and C- domains, and because the region containing only a1 and a2 helices seems to be too short to fold correctly, N- domain+ was...
... (b) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 Absorbance (a.u) Absorbance (a.u) TCNS15 TCNS10 TCNS5 TCNS3 TCNS1 TCNS0 800 Wavelength ( nm ) 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 3.8 4.0 Bandgap ... loading (TCNS5) and further increase results an activity decrease gradually Table BET surface area and particle size of the TCNS catalysts Catalyst TCNS0 TCNS1 TCNS3 TCNS5 TCNS10 TCNS15 Particle ... The band around 1730 cm-1 is attributed to carbonyl group and bands at 1130, 1040 cm-1 are corresponding to nitrite and hyponitrite groups present in TCNS5 and they are absent in TCNS0 which shows...
... sequence N- terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... p26 contains two novel N- terminal sequences, one enriched in glycine and the other in arginine Additionally, the C- terminus contains an unusual stretch of residues endowed with threonine and serine ... 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ R C- terminal extension TS XL1-blue supercompetent cells (Stratagene) p26 cDNA inserts were recovered by digestion with BamHI and XhoI, electrophoresis...