c fritz m a steiner a z 2011 examining the relationship between ovarian reserve as measured by basal fsh levels and the risk of poor obstetric outcome in singleton ivf gestations hump reproduction vol 26 no12 pp 3424 3430
báo cáo khoa học: " Impact: a case study examining the closure of a large urban fixed site needle exchange in Canada" ppt
... Learning from Each Other: Enhancing Community-based Harm Reduction Programs and Practices in Canada Ottawa/Toronto: Authors; 2008 DesJarlais D, Braine N: Assessing syringe exchange programs Addiction ... benefits of case study research are enhanced through the use of multiple sources of evidence, creation of a case study database and maintaining a chain of evidence In this study, we drew on documents, ... city took in 2004 to embrace harm reduction as a pragmatic, cost effective and socially responsible approach to reducing the personal and social harms associated with substance use In spite of...
- 8
- 311
- 0
Dấu hiệu và cách điều trị bệnh cúm A H5N1
... m c bệnh c m A H5N1: - Người chăn nuôi gia c m, người chế biến gia c m, người sống ph m vi vùng dịch c m - C c đối tượng nhạy c m c s c đề kháng trẻ em, phụ nữ c thai, người cao tuổi C ch điều ... hiệu nhi m c m Trẻ em đối tượng dễ bị lây nhi m cao s c đề kháng yếu, không nên cho trẻ chơi đ a c nh chuồng gia c m tiếp x c với gia c m Biến chứng nguy hi m từ bệnh c m A H5N1 Bệnh c m A H5N1 ... nhân nhi m c m A H5N1 c biểu sốt cao 39 độ C thu c paracetamol giúp người bệnh hạ sốt gi m đau đầu, đau khó chịu không dùng thu c hạ sốt nh m salicylate aspirin Trường hợp xảy bội nhi m vi khuẩn,...
- 5
- 7
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA ... used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT ... single mutants and of the omcA– omcB– double mutant strains of MR-1 Single omcA– and omcB– mutants and a double omcA– omcB– mutant strain of MR-1 were generated by insertional inactivation using the...
- 11
- 731
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢ The PCR product was cloned ... of Bradford [50], using BSA as standard Ascorbic acid determination Mycobacterial cells were extracted with 5% m- phosphoric acid [51] or 5% perchloric acid [52], as described Ascorbic acid was ... mycobacterial enzyme acts exclusively as a dehydrogenase and does not use molecular oxygen as an electron acceptor In contrast to the animal and plant l-gulono-1,4-lactone oxidoreductases, the mycobacterial...
- 11
- 571
- 0
Giải đáp thắc mắc "A-Z" khi tập thể dục ppt
... bỏ qua yoga pilates Nó hiệu m lại thư giãn vô C n bảng m n thể thao chuyên gia đ a theo m a để l a chọn: M a xuân: c u lông, bóng n m, tennis, bóng bàn M a hè: bơi lội, bóng đá, bóng chuyền, ... khỏe m nh xương, tim gi m nguy m c nhiều bệnh kh c đấy! Tăng c n nhờ tập thể d c có dẫn đến béo phì? Th c lên c n không th c béo lên, chí lượng chất béo dư th a thể bay hết nhường chỗ lại cho ... Thế nên bạn ch m tập thể d c ăn uống điều độ chẳng c phải lo lắng hết đâu nha! Tips l a chọn m n thể thao phù hợp Đầu tiên, bạn nên t m hiểu chút hiệu m n bao g m vị trí thể t c động m nh nhờ tập...
- 4
- 195
- 0
Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx
... endotoxin in mice Vascul Pharmacol 2006, 45:134-140 Slofstra SH, Groot AP, Maris NA, Reitsma PH, Cate HT, Spek CA: Inhalation of activated protein C inhibits endotoxin-induced pulmonary inflammation ... Gruber M, Zarini S, Murphy RC, Kuhn K, Richter D, Kast KR, Abraham E: Recombinant human activated protein C reduces human endotoxin-induced pulmonary inflammation via inhibition of neutrophil chemotaxis ... non-anticoagulant activated protein C J Exp Med 2007, 204:2439-2448 Bae JS, Yang L, Rezaie AR: Receptors of the protein C activation and activated protein C signaling pathways are colocalized in...
- 2
- 391
- 0
Khảo sát hoạt động tại trung tâm kiểm nghiệm thuốc mỹ phẩm, thực phẩm hải dương năm 2011-2013
... THÍCH TỪ NGỮ AAS : Atomic Absorption Spectrophotometer (Quang phổ hấp thụ nguyên tử) ASEAN : Association of Southeast Asian Nations (Hiệp hội qu c gia Đông Nam Á) BYT : Bộ Y tế CCVC : C ng ch c ... nh m dư c lý kh c có - m u không đạt n m Bảng 3.23 C c u m u không đạt theo hoạt chất ĐV tính: m u STT N m 2011 2012 2013 Vitamin C 1 Vitamin PP 0 Ciprofloxacin 0 Aspirin Cefixime 1 Albendazol ... n m, n m 2011 c 15 chất n m 2013 c 18 chất, tăng th m chất : dd asenit 1000mg/l, dd muối thủy ngân nitrat 1000mg/l, dd muối cadimi nitrat 1000mg/ml C c dung dịch m u, dung m i h a chất thuốc...
- 72
- 1,261
- 3
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... origin and an assurance of performance 21 Conclusively, a brand can be said to be a symbol of all facts associated with a product and service A brand commonly includes a logo, a name and any other ... Brand loyalty as the attachment that a customer has to a brand” It can also be seen as consumer’s preference to purchase a particular brand in a product class and this could be as a result of ... monetary, safety and social risk in purchasing services which are hard to ascertain before purchase Strong brands offer a lot of advantages such as reduced competition, larger brand loyalty and increase...
- 88
- 986
- 8
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... non-uniform temperature and moisture content of the cell which could in turn, potentially causing localized increases in the stress magnitudes, and this leads to mechanical damage, which can appear as ... of the fuel cell in lieu of a dedicated heat management system The model accounts for both gas and liquid phase in the same computational domain, and thus allows for the implementation of phase ... dehumidification of the membrane may occur, resulting in deterioration of protonic conductivity, increasing resistive losses, and increasing MEA temperature In the extreme case of complete drying,...
- 16
- 727
- 0
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... experience/performance and tenure/performance meta-analyses by Quiñones et al (1995) The manual search examined seven management journals—Academy of Management Journal, Administrative Science Quarterly, ... experience of the sample was greater than the mean organizational tenure of the sample As the intent of this study was to examine the relationships between temporal variables and performance, all covariates ... tenure/performance relationship, an increase in a sample’s tenure by one year was associated with a decrease in the relationship with performance by 0.013 (p < 01) For age, an increase of one year of a sample’s...
- 44
- 429
- 0
Focus - A simplicity manifesto in the Age of Distraction
... from consuming and communicating They don’t happen at the same time We can switch between them, but again, we’re hurting both processes as we that All the reading and consumption of information ... earlier, and became more organized And I’ve accomplished a lot more, taking on one project at a time and using the power of focus and the power of play to accomplish things: running a few marathons and ... raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point we need to actually sit down and create Or stand up and create...
- 121
- 552
- 1
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... Knowledge and Process Management series of essential factors in the success of the process and the advances made in KM in relation to innovation These include the main factors in the firm’s strategic change ... Irizar Tianjin (China), Irizar Magreb (Morocco), Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At ... of agreements between the bodywork and chassis makers for both coaches and trucks (Mercedes, Volvo and Scania) Irizar can be considered as an innovator in products, processes and in general management,...
- 10
- 1,063
- 1
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... which may include checkups and other procedures or therapies (Koopman, Baars & Mearin, 2003) In particular, childhood CD can affect how and what the whole family eat and this can make the family ... people and Coeliac Disease: Literature review 52 male, 71 female only) Questionnaire to assess adherence completed by dietician Canadian Rashid, Celiac Cranney, Association Zarkadas, Graham, Switzer, ... as pain management and possible trauma from medical procedures Indeed, “children with any kind of chronic disease have twice as many psychosocial problems as children not affected by chronic disorders”...
- 171
- 709
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, regional, national and ... only to tobacco as a theoretically preventable cause of cancer Consumption of adequate amounts of fruits and vegetables, and physical activity, appear to be protective against certain cancers Body ... diseases (CVD) are together with cancer the most important causes of death and disease in Europe Stopping smoking, increasing physical activity levels and adopting healthier diets are the most important...
- 22
- 703
- 0
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... both corporate and state and local governmental debt Part discusses the globalization of the agency bond rating business that has accompanied the globalization of capital markets since the 1970s, ... potential detriment of the owners and possibly guarantors of the assets Agency bond ratings could be used as one way of constraining the asset managers from acting in such a way As Martin Fridson, a ... rating business, a natural outgrowth of the financial and operating information it compiled and sold The company merged with Standard Statistics, another information and ratings company, in 1941,...
- 30
- 611
- 1
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... B-particles move independently of each other The only interaction occurs when a B-particle and an A- particle coincide; the latter instantaneously turns into a B-particle [KSb] gave some basic ... DMS9970943 and from Eurandom HK thanks Eurandom for appointing him as Eurandom Professor in the fall of 2002 He also thanks the Mittag-Leffler Institute and Eurandom for providing him with excellent ... Let A (·, ρ) be the random-walk paths associated to the various particles and (1) (2) assume that the Markov processes {Yt } and {Yt } are constructed by means of the same set of paths A (·,...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch ... absence of air The microscopical examination of any germ is quite as[ Pg 18] essential as the determination of culture characteristics; in fact, the two must go hand in hand The examination reveals ... rinsing water made In poorly cleaned cans, the average germ content was 442,000; in cans washed in tepid water and then scalded the best farm practice— 54,000, and in cans carefully washed and...
- 201
- 540
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... Japan, the Bank of England, the Bank of Canada, and Norges Bank The remaining central banks— the Reserve Bank of Australia, the Reserve Bank of New Zealand, and the Riksbank—appear to be operating ... however, the RBA accommodated increases, as demand for liquid and risk- free balances evidently became larger and more volatile during the initial months of the financial turmoil The level of aggregate ... when the initial target rate is very close to rcb and central bank balances are abundant The decrease in the quantity of balances demanded is larger in this case, indicating that the central bank...
- 49
- 653
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... Does Marketing Offer Public Policy? In an era of increasing political centrism and economic deregulation, marketing offers a philosophic and pragmatic middle ground In an era of increasing individual ... that this shift in focus has occurred in large part because most social marketing managers come from a public health or mass communications background, and few have had broad training in marketing ... at the core of commercial marketing, many who claim to practice social marketing have drifted far afield from this philosophic base Many policymakers and social marketing managers now seem to...
- 14
- 780
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose