bone marrow as a critical normal tissuethat limits drug dose exposure in preclinical models and the clinic1
SAVINGS BANKS'''' SOCIALLY RESPONSIBLE ACTIVITIES, A WEALTH OF EXPERIENCE: INSIGHTS FROM WSBI MEMBERS IN AFRICA, ASIA AND THE AMERICAS pot
... of savings and retail banks Founded in 1924, it represents savings and retail banks and associations thereof in 86 countries of the world (Asia-Pacific, the Americas, Africa and Europe – via the ... scholarships, educational material, and organises study tours for them Case Study 5: The Bank Simpanan Nasional Malaysia - Programme for habit of savings The Central Bank of Malaysia (Bank Negara ... ensure the participation of Brazilian Athletics Teams in more than 30 national and international competitions and in 15 other Caixa events that are part of the National Calendar of Sports Caixa also...
- 32
- 366
- 0
Strong, Safe, and Resilient A Strategic Policy Guide for Disaster Risk Management in East Asia and the Pacific
... Disasters in East Asia and the Pacific in the Last 30 Years 14 Weather and Climate-Related Disasters and Regional Average 1.2 15 Impacts, 2000–08 1.3 Growing Assets in Asia 16 1.4 Normalizing Losses ... ARPDM ASEAN Regional Programme on Disaster Management ASEAN Association of Southeast Asian Nations AusAID Australian Agency for International Development BNPB Indonesian National Disaster Management ... risk management work in Jamaica, Mexico, Peru, and Turkey as well as serving as the Regional Coordinator for Disaster Risk Management for Europe and Central Asia Abhas has also served as Advisor...
- 205
- 807
- 0
Báo cáo y học: "Familial, structural, and environmental correlates of MRI-defined bone marrow lesions: a sibpair study" pot
... for lateral and medial compartments, respectively X-rays A standing AP semiflexed view of the right knee was performed in all subjects at baseline and assessed according to the Altman atlas [16] ... follows: grade = normal cartilage; grade = focal blistering and intracartilaginous low-signal intensity area with an intact surface; grade = irregularities on the surface or basal layer and loss of ... bone at lateral tibia and/ or femora, medial tibia and/ or femora Each bone marrow lesion was scored on the basis of lesion size as described previously [10] A lesion was scored as grade if it was...
- 6
- 378
- 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 ... Hydroxyproline release was assayed as a measure of collagen degradation, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20] Collagenase and inhibitor activities in the ... metalloproteinases and their inhibitors and correlate this with pro-collagenase activation and aggrecan and collagen release Materials and methods Cartilage degradation assay Bovine nasal cartilage was...
- 12
- 526
- 0
Báo cáo y học: " Invasive pulmonary aspergillosis 10 years post bone marrow transplantation: a case report" ppsx
... infection, ear pain or discharge, facial pain or swelling, localised pallor of nasal septum or turbinate mucosa, and orbital symptoms Aspergillus may invade pulmonary vasculature leading to haemoptysis ... tissue attenuation surrounding a larger low attenuating circle of air and is indicative of bronchiectasis The diagnosis of invasive aspergillosis was made She was treated with intravenous voriconazole ... multifocal air space shadowing with at least 20 areas of disease and right upper lobe consolidation In addition, classical findings of halo sign and signet ring sign were reported (Figures and 2), in...
- 4
- 312
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... identified in a number of solid tumors, including renal carcinomas and, particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...
- 13
- 563
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, ... auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation ... a Measurement of the rate of CO binding was not feasible because of low heme binding affinity and instability of the protein markedly enhance the rate constants (Table 4) [5] This was surprising...
- 14
- 390
- 0
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... which involves carnitine palmitoyltransferase I, mitochondrial carnitine acylcarnitine translocase and carnitine palmitoyltransferase II [5–7] In case of the straight-chain and 2-methyl-branched ... catalyze the b-oxidation of the majority of FAs and contain the full enzymatic machinery to oxidize straight-chain, 2-methyl-branched-chain, and mono- and polyunsaturated FAs After uptake of FAs into ... oxidation Beta-oxidation is the preferred way of oxidizing FAs In principle, each FA can be b-oxidized, including straight- and branched-chain FAs, as well as monoand polyunsaturated FAs There is...
- 13
- 475
- 0
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... urokinase-type plasminogen activator is correlated with the malignant and invasive potential in meningiomas Cancer 89, 2292–2300 Jayaraman G, Srinivas R, Duggan C, Ferreira E, Swaminathan S, Somasundaram K, ... (B) A DNA fragment lacking 25 bases from the 3¢ end of pAAS-5 was amplified using DPP-III F-124 and DPP-III R-21 as the sense and antisense primers pAAS-1 was used as a template for the PCR The ... dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–681 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and characterization of a dipeptidyl aminopeptidase that...
- 15
- 325
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... carried out the molecular genetic studies and performed data analysis AJ has been involved in coordination of the study and drafting the manuscript MWC, WW performed the statistical analysis and ... 4B) was found This activity was 10 higher than in other cases which may indicate patients in metastasis stage Analysis of results demonstrated that in part of the studied blood samples of cancer ... Diagnostic, Cat No: 04688945001 TACTGCCCCACCATGACC CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (Roche Diagnostic,...
- 9
- 460
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 306
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 282
- 0
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf
... Center in Shreveport and signed informed consent was obtained from all participants Measurement of soluble HLA A solid phase ELISA was used to quantitate s-HLA-I and sHLA-II in the saliva obtained ... was started by adding O-phenylenediamine as a substrate The color intensity is proportional to sHLA concentration Absorbance was measured at 492 nm Saliva levels of sHLA-II were measured at baseline ... peroxidase labeled anti-beta2 microglobulin (L368) for sHLA-I and L.2.03 Mab for sHLA-II were added to each bead and incubated for an additional hour at 45°C After additional washes, the color reaction...
- 6
- 424
- 0
Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf
... For the purpose of having a basic understanding of the starting material, pristine graphite was characterized by elemental analysis (Table 2) When theoretical C H N O contents were calculated, the ... in NMP (0.2 mg/mL) and was able to pass through the dispersed solution, showing Tyndall scattering (Fig 5b) 7.58 anticipated Hence, graphite was also treated with TMPBA in the same reaction and ... pyrene and TMPBA could be clearly assignable from both 1H (Fig 3a) and 13C-NMR spectra (Fig 3b) The results further assure the feasibility of the reaction between pyrene and TMPBA On the basis...
- 6
- 392
- 0
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx
... Pancreatitis induced in mice by intravenous injection of caerulein was measured histologically, by determination of plasma amylase and lipase activity, and by immunoassays • In vitro and ex vivo ... periodontal disease and cardiovascular disease, which includes atherosclerosis, myocardial infarction and stroke In addition, epidemiological associations have been made between periodontal diseases and ... removal of the cervical sympathetic ganglia that innervate the salivary glands resulted in increased levels of SMR1 protein in the submandibular glands [19] These observations are in keeping with...
- 11
- 406
- 0
Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
... heart catheterization A balloontipped pulmonary arterial catheter was advanced to the pulmonary artery for measurement of pulmonary arterial pressure (PAP) and PWP In addition, a plastic catheter ... Authors' contributions HK participated in the conception and design, acquisition of data, analysis and interpretation of data, and drafting of the manuscript KA participated in the analysis and ... and abnormal proliferation of endothelial and vascular smooth muscle cells in pulmonary vessels, leading to vascular remodeling Indeed, VEGF has been found to be involved in vascular remodeling...
- 7
- 257
- 0
Báo cáo y học: "Fluid balance as a biomarker: impact of fluid overload on outcome in critically ill patients with acute kidney injury" potx
... particularly in those with oliguria or AKI Timing is crucial, and RRT should ideally be initiated as early and safely as possible [19] As a minimum, all critically ill patients should have an estimate ... resuscitative management has been accomplished Few clinical investigations, until now, have evaluated the impact that fluid balance has on clinical outcomes in critically ill adults with AKI [1] In a ... of baseline ‘dry’ weight and determination of the iatrogenic daily and cumulative fluid load and balance [20] Estimation of ‘dry’ weight can be problematic in the critically ill, and a clear priority...
- 3
- 270
- 0
A critical discourse analysis of medicine products advertisements in New Zealand Phân tích diễn ngôn phê phán các quảng cáo dược phẩm ở New Zealand
... help them to state the 29 advertising information and represent the ideologies in a natural and reliable way Medicine advertisers are advertising in the form of stating the fact, advertising in a ... popular websites for online medicine advertising in New Zealand Also, I have no ambition to make an analysis from all aspects of language used Rather, only word and grammatical choices are the main ... ‗positive‖ in that they bring the effective relief for the pain, have the magic ingredients with a reliable and clinically proven standards In another words, they contain all desirable quality in term...
- 58
- 544
- 3
THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY
... declarative and interrogative types Halliday and Matthiessen investigated MOOD in English, Japanese, Chinese, and some South East Asian languages (Thai, Vietnamese, Indonesian, and Korean) and they ... participant is the Sayer the participant saying, telling, stating, informing, asking, demanding, offering, threatening, suggesting and so on, The Sayer can be a human or human-like speaker, and also ... in the clause functions as the point departure for the message (labeled as Theme) and the remainder gives new information about the point of departure (labeled as Rheme) The clause as a message...
- 59
- 1,140
- 13
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... validate the mechanism of induction of GAL genes by galactose In each of the models, cytoplasmic Gal3p is activated by galactose Further, Gal4p dimerizes and interacts with the DNA to form the DNA–Gal4p ... represents binding of Gal4p dimer with DNA Parameter values are provided in the Appendix case, Gal80p binds as a monomer to activated Gal3p in the cytoplasm to relieve repression by Gal80p in the nucleus ... experimental observations However, the numerical values for the parameters (such as the binding constants) reported in literature are obtained experimentally and cannot assume arbitrary values It...
- 11
- 490
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008