before installing flame works no patient own the masticatory index of 75 but after fitting flame works there are 63 6 of patients with gt 75 points of this index this demonstrates that touching occlusal contact meets the requirements
thực trạng nhiễm hiv và các nhiễm trùng lây qua đường tình dục ở phụ nữ bán dâm 4 quận hà nội và hiệu quả một số biện pháp can thiệp bản tóm tắt tiếng anh
... districts of Ha Noi 2005 -20 06 4.1.1 HIV/STI prevalence in FSW in Ha Noi 2005 -20 06 4.1.1.1 HIV prevalence The survey in 2005-20 06 showed that the HIV prevalence in FSW of districts of Ha Noi was 16. 6%, ... warts in the year before the pre intervention survey The history of genital discharge in the groups of FSW did not different significantly (p=0.22), but the history of genital ulcer/wart of 15 venue ... with that of the whole country According to HIV sentinel surveillance, HIV prevalence in FSW group was around 3-5% during the period of 20032011, but that of Ha Noi was 13- 16% during the period of...
- 28
- 919
- 0
Báo cáo y học: "Suicide attempts and related factors in patients admitted to a general hospital: a ten-year crosssectional study (1997-2007)" pot
... function, and that the variance of the dependent variable is a known function Page of 10 of its expectation The parameters of the model are then estimated subsequent to the specification of the intracluster ... and others who are not (comparison group) Thus, the inference is not intended to be the general population, rather the sub-set of patients who are admitted to hospital Nonetheless, given the magnitude ... magnitude of the problem in this sub-set of patients, we feel that it is relevant to be able to define the variables associated with the attempted suicide, while clearly accepting that these are patients...
- 10
- 481
- 0
Real situation and Logistics applicability in freight forwarding of Haiphong Port – Recommendations to improve performance.doc
... 2001-20 06 Export 2001 2002 2003 2004 2005 20 06 1,3 36, 393 1, 365 ,4 76 1 ,757 ,845 1,792,4 46 2,349,119 2,925,092 throughput Import 4,357 ,60 6 5, 266 ,554 5,401,5 16 5, 365 ,62 4 5,1 96, 931 5,198 ,66 9 throughput ... 1523m/1000km2 45.5 63 . 7 375. 7 75. 9 32.8 The table above shows that, transportation infrastructure of Vietnam is poorly integrated The number of total roads of Vietnamese is not a small number, but the percentage ... areas, which are suitable for storage, handling, and transportation of each kind of cargo Of these warehouses, there is a standard Container Freight Station (CFS) Haiphong port has 750 0 m2 warehouse...
- 30
- 741
- 5
Indoor Air Pollution Associated with Household Fuel Use in India: An exposure assessment and modeling exercise in rural districts of Andhra Pradesh, India doc
... Female (6 15) 467 11 159 293 Female ( 16 60 ) 442 267 26 318 Female (61 –80) 431 19 117 282 NON-COOKS Female (2–5) 254 23 67 151 Female (6 15) 237 162 14 185 Female ( 16 60 ) 2 76 1 06 27 191 Female (61 –80) ... Female (6 15) 79 79 Female ( 16 60 ) 79 25 70 Female (61 –80) 103 42 93 Female (2–5) 69 69 Female (6 15) 77 74 Female ( 16 60 ) 72 10 66 Male (2–5) 77 73 Male (6 15) 82 10 79 Male ( 16 60 ) 79 32 76 Male ... those of the Executive Directors of The World Bank or the governments they represent The World Bank does not guarantee the accuracy of the data included in this work The boundaries, colors, denominations,...
- 114
- 415
- 0
correlation of depositors’ behavior and bank patronage in the inner districts of ha noi (3)
... different areas of Ha Noi with a questionnaire Ha Noi consists of 29 districts, of which 12 districts are inner city of Ha Noi and 02 rural districts are in the north of Ha Noi and 15 other districts ... Ha Noi? What are the profile of depositors in Ha Noi? What are the implications of depositors’ behavior? How are the depositors’ behavior and bank patronage correlated? What are the factors that ... causes the increase of interest rates To prevent the over-increase of the cost of funds that would negatively impact the economy and economic activities, the State Bank of Viet Nam set the cap...
- 162
- 235
- 0
situation of hiv, hbv, hcv infection and associated factors in some high risk populations in hanoi, 2008-2010
... IDUs 46 7.7 219 36. 7 254 42 .6 65 10.9 12 2.0 5 96 FSWs 31 5.3 244 41 .6 240 41.0 67 11.4 0.7 5 86 HDPs 1.8 64 16. 1 84 21.1 68 17.1 175 44.0 398 MTPs 63 15.8 117 29.3 70 17.5 55 13.8 94 23 .6 399 ... The rate of HIV, HBV, HCV coinfected IDUs Coinfection 2008 2009 2010 n (+) % n (+) % n (+) % HBV/HIV 86 13 15.1 75 6. 7 61 10 16. 4 HCV/HIV 86 74 86. 0 75 69 92.0 61 61 100 HBV/HCV/HIV 86 10.5 75 ... 57.2 138 66 .7 47 73.4 < 0.05 FSWs 38 25.5 44 20.1 64 27.7 0. 16 HDPs 20 28.2 1 06 35,2 32,1 0.52 MTPs 10 6. 3 16 6 .6 0.0 ABI 3130 The sequences were edited and contiguously assembled by software Seqman...
- 14
- 298
- 0
Actual situation study, some factors has risk to infect larva of toxocara canis in human and effect of treatment by albendazole at 2 commune of an nhon district, binh dinh province (2011 2012)
... treatment, there have been about 2.2% of patients exhibiting hair loss and recovering after that In our study of using drugs to treat 1 26 patients, after days, there were 03 patients showing the sign of ... 4/1 26 patients showing headache (3.2%); 5/1 26 patients showing fever (4.0%); no patients showing alopecia and 8/1 26 patients showing other symptoms (6. 4%) such as body pain, anorexia, tiredness After ... 47 patients in Hospital 103, the average age of subject group was 32 .66 ±13. 86 and most patients were 20-50 year old (74.47%) There were only patients of children under 10 year old (4.3%) This...
- 24
- 407
- 0
Efficiency Of Economic Linkage Between Enterprises And Farmers In The Southeast Region - The Current Situation And Affecting Factors
... but according to the approach of this study the nature of the linkage between farmers and businesses primarily as part of the economic linkages that there appeared an intrusive process, together, ... is cleared and evaluated the standart distribution will be analyzed by using SPSS and AMOS software to test the quality of the scale, the relevance of the model and study hypotheses of the relations ... Through the survey, the authors found that there are many forms of linkage between farmers and businesses However, the investment form of the enterprises from the inputs but not consumption of output...
- 16
- 390
- 1
DEPRESSIVE SYMPTOMS AND RELATED FACTORS OF THE GENERAL MEDICAL STUDENT AT HAI PHONG UNIVERSITY OF MEDICINE AND PHARMACY IN 2016
... 5th grade 6th grade Total n(%) Yes n (%) 26 ( 36, 6) 34 (34,0) 28 ( 36, 8) 46 (40,4) 26 (34,7) 29 (38,7) 189 (37) No n (%) 45 (63 , 4) 66 (66 ,0) 48 (63 , 2) 68 (59 ,6) 49 (65 ,3) 46 (61 ,3) 322 (63 ) Total ... The consequences of insensitive are that doctors not care about a mentality of patients and the relative’s patients They only think about how to cure, without thinking about the cost and whether ... stages of life The medical students often learn lessons about the theoretical exposure of patients and relative’s patients in critical cases, but not trained in skills of patient care in the final...
- 78
- 403
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... quality of life score for those with OAB was 3.4 of 6, and those without OAB 1 .6 Furthermore, 59% reported urge incontinence, 76% urgency, 90% frequency and 85% nocturia There was no association of ... routine screening Furthermore, our study shows that OAB is associated with age and a history of hepatitis Conflict of Interest The authors have declared that no conflict of interest exists References ... diagnosed with or treated for urinary symptoms (OAB, LUTS and/or BPH) Furthermore, those with OAB had a worse quality of life score Mean quality of life score for those with OAB was 3.4 of 6, ...
- 4
- 520
- 0
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc
... completely downregulated after treatment of the chick face with RA, and this is accompanied by an increase in apoptosis [73] The authors of this study ascribe the regulation of outgrowth of limb ... genes that determine the osteoblast phenotype, as the forced expression of Runx2 in nonosteoblast cells is sufficient to induce the osteoblast-specific gene osteocalcin [60 ] The inactivation of both ... results in a lack of osteoblasts throughout the skeleton [61 ,62 ] It has also been shown that deletions resulting in the heterozygous loss of runx2 cause cleidocranial dysplasia [63 ] Role of AP-2a, AP-2b...
- 9
- 642
- 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GCCATGCTAGCAATCATCACCGTAG GTTGAGATCTGTTGTTTACTTCTTC GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT AAGACAGGAATGGCGAGT AATCTCTCAGCTCTTCGGGAC ... synthesis was not measured, but this is a minor secretory product of Carcinus YO [11] Loss of sensitivity of YO to the inhibitory influence of crude SG extracts during premoult has been noted for the shrimp ... recruitment of new MIH receptors to the YO plasma membrane at this time, which is interesting in that this is nearly coincident with the resumption of competence of the YO at stage C1 Thus, it seems that...
- 9
- 587
- 0
Nutritional Status and Associated Factors in Institutionalized Elderly docx
... should be noted, however, that the purpose of the study was to evaluate the reality of ILPI and compare it with the literature, to contribute toward knowledge in the area and implementation of changes ... minerals, was not associated with nutritional status, or with socioeconomic data On the other hand, the mobility of the elderly, their financial contribution to the ILPI and frequency of visits were ... 26, 9 50,0 51,0 Niacin 65 ,4 23,1 11,5 46, 0 Vitamin B6 5,8 9 ,6 84 ,6 67,0 Vitamin B12 44,2 3,8 51,9 56, 0 Table 2: Qualitative and quantitative adequacy of micronutrient intake of the elderly of the...
- 5
- 552
- 0
Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx
... M 66 :p PE T1 A pP ET 66 PM :pP ET M PM 6: p PE M T1 66 : PM :pP pR ET S0 M 1: 66 pR :p S2 PE T1 :p R S2 Phthiocerol dimycocerosates in M tuberculosis DIM A PGL-tb DIM B 100 20 10 17 56 .6 1 866 .2 ... suppress the synthesis of PGL-tb in the mutant strain To examine whether the absence of PGL-tb in the cell envelope of the PMM 66: pPET1 mutant solely relied on a polar effect on the expression of Rv2949c ... fadD 26 (PMM137) mutant strain Black boxes represent portions of the fadD 26 gene that are still present in the PMM137 chromosome, and the hatched box represents the portion of the fadD 26 gene that...
- 11
- 550
- 0
The Fraction of Cancer Attributable to Lifestyle and Environmental Factors in the UK in 2010 docx
... OPEN logo and details of the precise terms of the licence that applies to it How does this affect the review of my paper? It doesn’t – BJC will not discuss the BJC OPEN option with authors until ... avoidable causes of the disease It therefore offers a useful guide to the relative imporance of different preventive interventions Excluded from consideration are factors that, although known to be ... currently known causes of cancer Conflict of interest The author declares no conflict of interest This work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported...
- 92
- 563
- 0
Common factors in the performance of European corporate bonds – evidence before and after financial crisis pdf
... -7 .64 -7. 56 66. 7 0 .69 7 -7. 06 -6. 98 79 .6 0.8 16 -6 .75 -6. 66 81.2 0.990 -6. 36 -6. 28 72.1 1.2 56 -5.88 -5.80 29 Table 4: Results of the orthogonal model This table presents the results of the following ... 1.7057 (6. 06) ** (5.25)** (15.28)** (0 .65 ) (7 .63 ) ** 0. 268 3 0. 263 0 0. 368 7 -0. 168 6 1.5 366 (7.74)** (1.87) (14.15)** (-0. 96) (2.95)** 0. 366 2 0.3718 0.5814 -0.0378 1.9 360 (10.03)** (2.47)* (19. 26) ** (-0.18) ... -1 .62 -1.22 -0.29 0.38 -1.11 -0.35 -0.51 -0 .64 2.78 6. 06 6. 56 0 .68 2.91 4.52 5.44 1.89 3.94 7.18 8.22 6. 31 2. 06 5.20 7.85 6. 17 6. 18 3.24 40.83 1 56. 33 169 .17 1.93 40.53 94.27 134. 26 14.32 62 .43...
- 42
- 402
- 0
Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx
... shown that RFRP-immunoreactive fibers are widely distributed within the brain [44] Expression of the main receptor for RFRP, GPR147, is broadly distributed within the brain, including the septal areas, ... does not change the expression of RFRP in Siberian hamsters [47] The effects of RFRP upon energy consumption or oxygen consumption are not known The downstream and physiological significance of ... of leptin are impaired in PrRP-deficient mice [13] These data suggest that the anorectic effects of leptin signaling are mediated, at least in part, by PrRP Role of PrRP in the control of energy...
- 8
- 489
- 0
unsicker - cell signaling and growth factors in development
... Development of Reproductive Tracts 963 Patterning of the Reproductive Tracts 964 Morphogenesis of the External Genitalia 966 Summary 967 26. 1 26. 2 26. 2.1 26. 2.2 26. 3 26. 3.1 26. 3.1.1 26. 3.1.2 26. 3.1.3 26. 3.1.4 ... Axis 562 Contents 15.4.2 15.4.3 15.5 15 .6 15 .6. 1 15 .6. 2 15.7 16 16. 1 16. 2 16. 2.1 16. 2.2 16. 2.3 16. 3 16. 3.1 16. 3.2 16. 3.2.1 16. 3.2.2 16. 3.2.3 16. 3.2.4 16. 4 16. 5 17 17.1 17.2 17.2.1 17.2.2 17.2.3 ... Introduction 755 Development of the Gastrointestinal Mucosa 7 56 Specialization of Epithelium and Functional Units 7 56 Esophagus 7 56 Stomach 7 56 Small Intestine 7 56 Colon 757 Mesenchymal-Epithelial...
- 1,083
- 320
- 0
báo cáo sinh học:" Existing capacity to manage pharmaceuticals and related commodities in East Africa: an assessment with specific reference to antiretroviral therapy" ppt
... each of the four countries The specific objective of the assessment was to determine the existing capacity of the health care system to select, quantify, distribute, and use ARVs; determine the ... Survey of health facilities and programs The heads of the facilities providing ART services in the four countries were the key informants at the program level The survey looked at the types of HIV/AIDS ... HRN-A-00-00000 16- 00 The opinions expressed herein are those of the authors and not necessarily reflect the views of the United States Agency for International Development References The Global Fund...
- 5
- 376
- 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf
... It is therefore of concern that 6% of individuals with an AIDSdefining illness were not provided therapy There was no indication as to why these individuals were not treated It should be noted, ... to HAART This analysis was restricted to 578 of the 64 8 patients, because 69 (11%) individuals did not have CD4 measurements within 12 months prior to the initiation of HAART Compared with those ... antiretroviral therapy in Argentina The proportion of patients with AIDS at enrollment suggests that a late HIV diagnosis appears to be common Page of (page number not for citation purposes) Journal of the...
- 7
- 398
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25