based on flesh and blood not being able to enter the kingdom
The Breast Cancer Epidemic: Modeling and Forecasts Based on Abortion and Other Risk Factors potx
... abortion statistics are used to derive abortion rates for Northern Ireland The trends in abortion and fertility in Northern Ireland are shown in Figures and Abortion rates in Ireland, where abortion ... thanks are due to the charities LIFE and The Medical Education Trust, which funded the research, to the national statistical offices and cancer registries, which provided the data, and to the statisticians ... childlessness The correlation in the graph is negative, and this variable is not used in the model to explain the British trend Two explanatory variables are selected for modeling: x1 (abortion) and x2...
- 7
- 405
- 0
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx
... the pri-miRNA rather than cytoplasmic export, and should favor cytoplasmic export and translation for the EGFP component, rather than intranuclear degradation We denoted these modified miRNA -based ... with the parental and modified vectors containing control and Luc targeting sequences and the efficiency of down-regulation assessed (Fig 3) Expression of Luc artificial miRNA from the modified vectors ... artificial miRNA sequences into the targeting vectors The terminal regions of the arms of the miR155 (A) and miR30 (B) vectors are shaded, and their stems designed to be replaced by artificial...
- 7
- 514
- 0
photocatalytic nanocomposites based on tio2 and carbon nanotubes
... valence band and an empty conduction band When a photon with energy of hν matches or exceeds the bandgap energy of the semiconductor, an electron is excited from the valence band into the conduction ... metal islands of Ag, Au and Cu becomes inhibited as their Fermi-level shifts close to 17 the conduction band of the semiconductor Pt on the other hand acts as an electron scavenger and fails to achieve ... rate constant [133] Degradation and mineralization can be monitored by determining sulfate ion and total organic carbon concentrations in the reaction solution In this study, the reduction in the...
- 107
- 555
- 0
09 - personalized email prioritization based on content and social network analysis
... by the clustering algorithm based on the user’s personal social network An element of the subvector is if the user belongs to the corresponding cluster and otherwise; each user can belong to only ... elements to be 1/N Then update this vector iteratively: r(k+1) = Er(k) The vector converges to the principal eigenvector of matrix E when k is sufficiently large The stationary vector contains one ... set was not in the training set, the LSPR subvector of this message was assigned to the mean of LSPR vectors by default The concatenation of all these subvectors yields a synthetic vector per...
- 7
- 537
- 0
Báo cáo khoa học: Structural requirements for Caenorhabditis elegans DcpS substrates based on fluorescence and HPLC enzyme kinetic studies pdf
... where co is the initial concentration of the substrate, and It, Io and Ie are the fluorescence intensities at time t, at the beginning and at the end of the reaction, respectively The initial ... lysozyme was added to a final concentration of mgỈmL)1, the suspension was incubated on ice for 30 min, and then sonicated on ice (15 · 30 s every min) The · His-tagged DcpS was bound to Ni2 + - nitrilotriacetic ... withdrawn and the reaction was terminated by heat inactivation of the enzyme (2.5 at 100 °C) The samples were then subjected to HPLC analysis as described above The concentration of the examined...
- 11
- 438
- 0
Báo cáo khoa học: "The Corpora Management System Based on Java and Oracle Technologies" potx
... document to fmd queries XML path searching is able to perform sophisticated section searches: doctype disambiguation, attribute value searching, automatic section indexing, and more In addition to the ... groupings The resulting patterns reveal the conceptual backbone of the text collection Russian WordNet is used for basic conceptual grouping • Automatic Corpora Text collection, tokenization, part-of-speech ... text annotation System could be easily adapted to different software platforms (Java and Oracle) and the necessities of other languages (Unicode), making the whole system portable to other platforms...
- 4
- 346
- 0
mechanical properties of polymers based on nanostructure and morphology, 2005, p.738
... habits, the latter geometrically related to the former by bisection along the short diagonal, parallel to b, then a 180° rotation around the a axis and, finally, reconnecting the two halves The important ... have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use No ... suggested to arise from surfaces being formed rough and unable to lie parallel This is, therefore, a second factor contributing to lamellar divergence and spherulitic growth It is likely to contribute...
- 738
- 2,816
- 0
báo cáo hóa học: " Human-machine interfaces based on EMG and EEG applied to robotic systems" pot
... wheelchair taking the operator to the rooms of a house or office, for example In the second one, the operator uses the BCI to An operator is considered capable of having full control of the BCI if he ... with the reference connected to an ear lobe (according to the 10–20 international system of electrodes positioning) ator is invited to command the robot in a simulation environment, and, in the ... left and go back to the mobile robot all cells and the analysis of the signal power of the user's EEG signal in the alpha frequency band is used to select one of them The selection is done when...
- 15
- 379
- 0
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf
... seen, the results of the UMTS link offer the worse results, due to the delay of the operator’s network and the bandwidth limited by the radio coverage and the available resources in the cell The ... 10, these conditions are only present in this segment, since the rest of roads have a clear space on one side This fact enables the reflection of signals on the various walls Moreover, the second ... for the first access point, and then an additional 10 seconds for the second one As the speed of the vehicle was 10 km/h, the coverage of the access points can be estimated to be between 30 and...
- 18
- 596
- 0
Báo cáo sinh học: " Research Article Improved Adaptive LSB Steganography Based on Chaos and Genetic Algorithm" ppt
... generation is recombined to find the best solution by using three operators: selection, crossover, and mutation [13] The process is repeated until a predefined condition is satisfied Once we have the ... features in the proposed method are to minimize the degradation of stego image by shuffling the secret message based on the logistic map and GA To find better mapping between the secret message and the ... coefficients should not be changed to On one hand, characteristics of histogram can be preserved; on the other hand, message bits can be extracted correctly and simply If si = 0, si = si ± 2l To add or...
- 6
- 343
- 0
Báo cáo sinh học: " Research Article Robust Iris Verification Based on Local and Global Variations" pptx
... noise Another probable reason is the high contrast and quality of the texture in the corresponding regions In the best case, high frequency components of the signature are not reliable Since the ... restricted to the area not affected by them Hence, the areas confined to two opposing 90◦ cones centered on the horizontal axis are searched for the outer boundary Indeed, the method is performed on the ... possible to define linear and nonlinear boundaries and consequently a variety of linear and nonlinear fusion rules The position and distance of the new test point relative to the decision boundary...
- 12
- 359
- 0
Báo cáo hóa học: "Research Article Mode Switching for the Multi-Antenna Broadcast Channel Based on Delay and Channel Quantization" pot
... in [14] the analysis based on the quantization cell approximation is close to the performance of random vector quantization, and so we use this approach to derive the achievable rate The following ... section 14 12 B = 15 Based on the distribution of the interference terms, the approximation for the achievable rate for the MU mode is given in the following theorem Theorem The ergodic achievable ... quantization cell approximation [40, 41], the quantization cell approximation is based on the ideal assumption that each quantization cell is a Voronoi region on a spherical cap with the surface...
- 15
- 367
- 0
Báo cáo hóa học: " Synthesis of High Coercivity Core–Shell Nanorods Based on Nickel and Cobalt and Their Magnetic Properties" pot
... due to the difference in the growth rate between Ni and Co, as their precursors are being different Moreover, the extra hydration layer in Ni ions also may reduce the mobility and in turn the ... Transmission electron microscopy (TEM) experiments were performed using JEM 2010 transmission electron microscope Results and Discussion The formation of Co NT and the subsequent formation of Ni ... is to be concluded that mobility of the cation and hydration layer are important parameters determining the morphology of one-dimensional structure after electrodeposition Figure 2a shows the...
- 5
- 405
- 0
Báo cáo hóa học: " Research Article Active Video Surveillance Based on Stereo and Infrared Imaging" doc
... by the user, the detected target is recognized and the procedure goes on with the active tracking Otherwise, wrong target recognition occurs and the automatic target search is applied to the ... in the MM database using information in a set obtained considering the shape information stored at the time of the initial target selection joined with the one of the last valid shape If the candidate ... an m-dimensional vector consisting of the concatenation of the m SOMs outputs (in our case, m = 3) This vector represents the input of the second level The recognition level consists of a neural...
- 8
- 276
- 0
Báo cáo hóa học: " Research Article Demosaicking Based on Optimization and Projection in Different Frequency Bands" pdf
... the demosaicking is performed in two steps The first step is reconstruction: the green component is first reconstructed using the red and blue gradients, and then the red and blue ones are reconstructed ... Section presents and discusses the simulation results Section concludes the paper with a brief summary We use the following notation Let R, G, and B pixel values correspond to the red, green, and ... the edge indicator at position (i + l, j + m) The main goal is to smooth the low-frequency components of the chrominance in the edgy regions To this, we propose to consider only pixel locations...
- 14
- 354
- 0
Báo cáo hóa học: " Flexible Analog Front Ends of Reconfigurable Radios Based on Sampling and Reconstruction with Internal Filtering" pdf
... for the analog -to- digital converter (A/D), and conversion of the signals to the frequency most convenient for sampling and quantization Besides, they often provide band selection, image rejection, ... than conventional structures SIMPLIFICATION OF THE SCs AND RCs Approaches to the problem Approaches to simplification of the SCs and RCs depend on the ways of wn (t) generation and multiplications ... up-conversion architecture, (b) offset up-conversion architecture with baseband reconstruction, (c) offset up-conversion architecture with bandpass reconstruction of the transmitter RF band, the...
- 18
- 275
- 0
Báo cáo hóa học: " Audio Watermarking Based on HAS and Neural Networks in DCT Domain" doc
... Calculation of the power spectrum Step 2: Determination of the threshold in quiet (absolute threshold) Step 3: Finding the tonal and nontonal components of the audio Step 4: Decimation of tonal and nontonal ... training audio as the testing audio On the other hand, the adaptive and robust capabilities of the method can be simultaneously assessed by taking the distorted-andwatermarked audio as the testing ... NSC 89-2218-E-150-010 and NSC 89-2218-E-194-010, respectively Gratitude is extended to the anonymous reviewers for their valuable comments and professional contributions to the improvement of this...
- 12
- 420
- 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx
... probesets with contradictory responses to stress (expression significantly increased in one condition, but significantly decreased in another) were not considered Functional annotation was then assigned ... sequences specific to the cloning adaptor strategy To precisely identify and fully mask the vector/adaptor region 5’ to the inserted cDNA fragment the “canonical adaptor region” (5’TTGTAAAACGACGGCCAGTGAATTGTAATACG ... construction KAS performed hierarchical clustering analysis and data interpretation and finalization of the manuscript GRC participated in the organization of the studies and finalization of the...
- 23
- 403
- 0
Báo cáo y học: " Short-term prediction of threatening and violent behaviour in an Acute Psychiatric Intensive Care Unit based on patient and environment characteristics" pps
... http://www.biomedcentral.com/1471-244X/11/44 The environment-related condition in the inclusions thus was the use of the PICU as a segregation area or not [15] The difference between the inclusions as a possible predictive factor for ... days a total of (inclusion 1) (the PICU-condition with complete segregation) and 19 (inclusion 2) (the PICU-condition without complete segregation) (RR 5.72, p < 0.01(Poisson distribution), 95% ... indicates that the model contributes powerfully to the prediction of the SOAS-R incidents or non-incidents The variables BVC, “Physicians prediction”, and “Segregation” contribute significantly to predict...
- 7
- 319
- 0
Báo cáo sinh học: "Prediction of plant promoters based on hexamers and random triplet pair analysis" ppt
... followed by the second triplet in RTP, and candidate_hexamer to be the concatenation of the second triplet followed by the first triplet in the RTP The discrimination power of the two candidate ... validation was used for them For the other tools, the training data was not required And the same test_datak was used for testing all the tools Then, using test_datak datasets, we measured the sensitivity ... hexamer_setk rather than the top 35% The reason for this is that we wanted to keep the size of the feature set as small as possible thus avoiding overfitting Table presents the top 10 ranked common hexamers...
- 10
- 309
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25