Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

Design of expression vectors for RNA interference based on miRNAs and RNA splicing Guangwei Du, Joshua Yonekubo, Yue Zeng, Mary Osisami and Michael A. Frohman Department of Pharmacology and the Center for Developmental Genetics, Stony Brook University, NY, USA Target genes can be silenced by transfection of chemic- ally or enzymatically synthesized small interfering RNAs (siRNA) or by DNA-based vector systems that encode short hairpin RNAs (shRNAs) that are further processed into siRNAs in the cytoplasm. The initially designed and most widely used vector-based RNA interferences (RNAi) are driven by RNA polymerase III promoters, e.g., H1 and U6 [1,2]. Several recent RNAi vectors driven by polymerase II promoters are based on endogenous small RNAs ( 22 nucleotides) known as microRNAs (miRNAs) that can also guide cleavage of RNAs and ⁄ or translational inhibition. Cul- len and colleagues first described this kind of RNAi vector in which a synthetic siRNA ⁄ miRNA is expressed from a synthetic stem-loop precursor based on the miR30 miRNA precursor [3]. Subsequently, other groups have developed additional miR30- or miR155-based vectors for RNAi [4–6]. The expression of siRNAs from the artificial miRNA driven by an RNA polymerase II promoter offers several advan- tages over an RNA polymerase III promoter, including expression of several artificial miRNAs from a single transcript, and tissue-specific or regulated expression [4,6,7]. In animals, primary miRNAs (pri-miRNAs) are transcribed by RNA polymerase II, and contain 5¢ CAP structures and 3¢ poly(A) tails [8,9]. The pri- miRNA is recognized and cleaved at a specific hairpin site by the nuclear microprocessor complex, which con- tains an RNase III family enzyme, Drosha, to produce a miRNA precursor (pre-miRNA) of approximately 70–90 nucleotides with a 2 nucleotide 3¢ overhang [10– 14]. This distinctive structure activates transport of the pre-miRNA to the cytoplasm by Exportin-5 [8,9,15]. Keywords intron; miRNA; RNA interference; RNA splicing; small-hairpin RNA Correspondence G. Du, Department of Pharmacology and the Center for Developmental Genetics, Stony Brook University, Stony Brook, NY 11794-5140, USA Fax: +1 631 632 1692 Tel: +1 631 632 1477 E-mail: guangwei@pharm.stonybrook.edu (Received 13 July 2006, revised 9 Septem- ber 2006, accepted 11 October 2006) doi:10.1111/j.1742-4658.2006.05534.x RNA interference (RNAi) mediates sequence-specific post-transcriptional gene silencing in many eukaryotes and is used for reverse genetic studies and therapeutics. RNAi is triggered by double-stranded small interfering RNAs (siRNAs), which can be processed from small hairpin RNAs gener- ated from an expression vector. In some recently described vectors, the siRNAs are expressed from synthetic stem-loop precursors of microRNAs (miRNAs) driven by polymerase II promoters. We have designed new RNAi vectors, designated pSM155 and pSM30, that take into considera- tion miRNA processing and RNA splicing by placing the miRNA-based artificial miRNA expression cassettes inside of synthetic introns. Like the original miRNA vectors, we show that the pSM155 and pSM30 constructs efficiently down-regulate expression of firefly luciferase and an endogenous gene, phospholipase D2. Moreover, the expression of a coexpressed fluores- cent marker is substantially improved by this new design. Another improvement of these new vectors is incorporation of two inverted BsmBI sites placed internal to the arms of the new miRNA-based vectors, so oligos used for cloning are shorter and the cost is reduced. These RNAi vectors thus provide new tools for gene suppression. Abbreviations EGFP, enhanced green fluorescent protein; miRNA, microRNA; pre-miRNA, miRNA precursor; PLD2, phospholipase D2; pri-miRNAs, primary miRNAs; RNAi, RNA interference; siRNAs, small interfering RNAs; shRNAs, small-hairpin RNAs. FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS 5421 The pre-miRNA is then recognized by another RNase III, Dicer, and cleaved to produce a mature miRNA of  22 nucleotides. miRNAs can be categorized into three groups according to their genomic context: exon- ic miRNA in noncoding transcripts, intronic miRNAs in noncoding transcripts, and intronic miRNAs in protein-coding transcripts [8,9]. Based on the accumulating knowledge on miRNA biogenesis, we report here the development of vectors in which the artificial miRNAs are expressed from arti- ficial introns. The artificial miRNAs expressed from both miR30- and miR155-based miRNA precusors using this strategy efficiently knockdown expression of the luciferase reporter and an endogenous gene. More- over, this vector also provides a robust marker for the artificial miRNA-transfected cells. Results and Discussion Generation of miRNA-based RNAi vectors based on RNA splicing Recent strategies have described coupling fluorescent protein expression directly to artificial miRNA expres- sion in order to provide a way to identify transfected cells genuinely expressing the artificial miRNA [4,6,7]. An example of this design is shown in Fig. 1A [4]. As shown, the pri-miRNAs based on miR155 are proc- essed in the nucleus by Drosha to set up transport of pre-miRNAs to the cytoplasm, where they are further processed to siRNA. However, this process simulta- neously blocks the translation of the enhanced green fluorescent protein (EGFP) marker, because the result- ing mRNA fragment lacks a 5¢ CAP structure and is rapidly degraded. EGFP can be translated if the pri- miRNAs are exported to the cytoplasm before Drosha cleavage; but siRNAs are then not produced from these unprocessed pri-miRNAs. Similar issues apply to the original miR30-based vectors (Fig. 1B) [6,7]. We hypothesized that both functions could be accommodated if the pri-miRNAs were processed in nuclei without inactivating the EGFP component. To achieve this, we inserted the miR155 and miR30 artifi- cial miRNA-expressing cassettes into a chimeric intron composed of the 5¢ donor site from the first intron of the human b-globin gene and the branch and 3¢ accep- tor site from the intron of an immunoglobulin gene heavy chain variable region (derived from pCI-neo from Promega) (Fig. 1C,D). This design mimics the structure and processing of some natural miRNAs AC DB Fig. 1. Strategy for improved RNAi knockdown and ⁄ or marker gene expression. (A,B) In the original miRNA-based artificial miRNA expres- sion vectors, pmiR155 (A) and pmiR30 (B), the artificial miRNA and EGFP segments are coexpressed as a combined exonic transcript. EGFP would not be expected to be efficiently translated because the processing of the miRNA leads to a cleaved mRNA product that is not stable and degrades quickly. (C,D) Placing the miRNA-based artificial miRNA expression cassette in a synthetic intron in pSM155 (pSpliced miR155) and pSM30 (pSpliced miR30) might increase the production of siRNAs and the expression of EGFP, because the RNA precursors for both can be processed better or stabilized in the nuclei. Artificial miRNA from introns G. Du et al. 5422 FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS which consist of intronic miRNAs in protein-coding transcripts [8,9]. Separation by splicing of the miRNA component from the 5¢ CAP-exon-EGFP-3 ¢ poly(A) component should facilitate Drosha processing of the pri-miRNA rather than cytoplasmic export, and should favor cytoplasmic export and translation for the EGFP component, rather than intranuclear degra- dation. We denoted these modified miRNA-based RNAi vectors, pSM155 (Spliced miR155, Fig. 1C) and pSM30 (Spliced miR30, Fig. 1D). To simplify the cloning of artificial miRNAs with- out substantially altering the miRNA arm sequences, inverted BsmBI sites were placed internal to the arms of pSM30 and pSM155, as well as to those of pmiR30 and pmiR155 (Fig. 2A,B). A pair of oligo- nucleotide primers with appropriate 4 nucleotides overhangs can be easily ligated to the cohesive sites of the vector generated by BsmBI digestion. The sequences and predicted precursor structures from the oligonucleotide primer pairs used in this study are lis- ted in Fig. 2C. The pSM155 and pSM30 vectors generate efficient knockdown of target proteins To examine the efficiency of generation of RNAi for pSM155 and pSM30, we examined the knockdown of expression of firefly Luciferase (Luc). HeLa cells were transfected with the parental and modified vectors con- taining control and Luc targeting sequences and the efficiency of down-regulation assessed (Fig. 3). Expres- sion of Luc artificial miRNA from the modified vec- tors SM155 and SM30 yielded consistently better knockdown than the parental vectors pmiR155 and pmiR30, although the degree of improvement was modest. These findings imply that expression of miRNA-based siRNAs from an intron may improve RNAi to a small extent. We then examined the down-regulation of an endo- genous gene, phospholipase D2 (PLD2). PLD2 hydro- lyzes phosphatidylcholine to generate choline and the bioactive lipid phosphatidic acid, and has been impli- cated in signal transduction, membrane trafficking, transformation, and cytoskeletal reorganization [16,17]. HeLa cells were transfected with miRNA-based con- structs expressing artificial miRNAs against PLD2. Artificial miRNAs expressed from both pmiR155 and pSM155 significantly down-regulated the expression of endogenous PLD2, although in this case a signifi- cant improvement of PLD2 knockdown by pSM155 construct over pmiR155 was not observed (Fig. 4). Fig. 2. Improved strategy for inserting specific artificial miRNA sequences into the targeting vectors. The terminal regions of the arms of the miR155 (A) and miR30 (B) vectors are shaded, and their stems designed to be replaced by artificial miRNA sequences directed against genes of interest. Two inverted BsmBI sites (underlined) were introduced as shown. Because the cutting sites of BsmBI are outside of the recognition sites, BsmBI digestion leaves the miRNA arms unchanged and generates two different cohesive ends into which a synthetic DNA duplex can be inserted to replace the original miR155 or miR30 sequences. The cloning of luc-C artificial miRNA sequences (shown as grey font) is shown as an example. The central black font indicates the loop region. (C) Sequences and predicted precursor structures for miRNA-based artificial miRNA used in this study. Artificial miRNA expression is driven by a cytomegalovirus (CMV) promoter. The stems of miR30 or miR155 were replaced with sequences that were complementary to the firefly luciferase (luc) and phospho- lipase D2 (PLD2) (shown as grey fonts). G. Du et al. Artificial miRNA from introns FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS 5423 Labeling of artificial miRNA-transfected cells by EGFP is significantly improved by the use of pSM155 and pSM30 It is necessary to be able to identify artificial miRNA- transfected cells in some RNAi experiments, especially when the transfection efficiency is low. In the RNA polymerase III promoter-driven shRNA expression vectors, fluorescent proteins (e.g., EGFP or dsRed, a red fluorescent protein from Discosoma sp. reef coral) are typically used as the marker and are expressed from a separate RNA polymerase II promoter. Expres- sion of the artificial miRNA and the marker from a single RNA transcript in the miRNA-based expression systems provides a more tightly linked marker that directly indicates the level of expression of the artificial miRNA. However, as discussed above, directly linking the marker ORF to a miRNA-based artificial miRNA expression cassette as shown in Fig. 1A may lead to inefficient translation of the marker protein [6,7]. We thus tested if the new pSM155 and pSM30 vectors improve expression of the EGFP marker. HeLa cells were cotransfected with artificial miRNAs directed against firefly luciferase or PLD2 in the pmiR155 or pSM155 vectors described above, and pcDNA3.1-mCherry, which encodes a red fluorescent protein, to identify transfected cells. EGFP expressed poorly in the pmiR155 plasmids carrying the luciferase and PLD2 artificial miRNAs. However, the expression of EGFP was dramatically improved in the cells trans- fected with the pSM155 constructs expressing the same artificial miRNAs (Fig. 5A). To further confirm that the pSM155 indeed increases expression of the marker protein, expression of EGFP was also measured by western blotting. HeLa cells were cotransfected with the artificial miRNAs against firefly luciferase or PLD2 in the pmiR155 or pSM155 vectors, and pRK- human IgG, as a transfection and loading control. EGFP expressed poorly in the cells transfected with the pmiR155 constructs, but at very high levels in the cells transfected with pSM155 constructs (Fig. 5B). We also compared the expression of EGFP when the EGFP ORF is directly linked to the miR30 artificial miRNA expression cassette (pmiR30) or to the same cassette located inside the synthetic intron (pSM30, Fig. 1C,D). Again, the expression of EGFP was signifi- cantly improved for the pSM30 artificial miRNA tar- geting vectors, as measured by fluorescent microscopy (Fig. 5C) and western blotting (Fig. 5D). These results demonstrate that introducing the splicing sequences for the miRNA expression cassette is a successful general strategy for improving marker gene protein expression. In this study, insertion of the miRNA-based artificial miRNA expression cassette into an intron AB Fig. 3. Efficient knockdown of luciferase expression by an intronic miRNA approach. HeLa cells were transfected with artificial miRNAs directed against firefly luciferase in pmiR155 or pSM155 (A), or pmiR30 or pSM30 (B). Renilla luciferase plasmid served as the transfection control. The luciferase activities were normalized to the value measured in lysates from cells transfected with control empty vectors. The values presented are means with standard deviation (n ¼ 3). Fig. 4. Knockdown of endogenous PLD2 using pmiR155 and pSM155. HeLa cells were transfected with artificial miRNAs against luciferase (control) and PLD2 in pmiR155 and pSM155. Cell lysates were collected for western blotting two days after transfection. PLD2 and a-tubulin were detected by a polyclonal antibody and a mouse monoclonal antibody, respectively, followed by goat anti- rabbit secondary IgG conjugated to Alexa 680 and goat anti-mouse conjugated to IRDye 800. Fluorescence was quantitated using an Odyssey infrared imaging system from LI-COR Bioscience-Biotech- nology (Lincoln, NE, USA). Artificial miRNA from introns G. Du et al. 5424 FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS significantly increased expression of the marker pro- tein. Insertion of a miRNA-based artificial miRNA expression cassette into an intron was recently reported by two other groups [4,18]. In both cases, the miR155 and miR30 cassettes were placed into the first intron of the human ubiquitin C gene [4,18]. However, the efficiencies of RNAi and marker gene expression were not compared between the original and modified vec- tors. Our results demonstrate that the incorporation of an intronic strategy offers a modest at best improve- ment in the efficiency of RNAi, but generates a dramatic improvement in marker gene expression. This result suggests that Drosha processing of the pri- miRNA is relatively efficient even when the miRNA cassette is in an exon, but correspondingly that most of the marker protein expression is lost through degra- dation of the resulting unstable mRNA that lacks a 5¢ CAP structure (Fig. 1A). The success of these vectors using a synthetic intron also indicates that the con- served sequences for mRNA splicing (5¢ donor, branch, and 3¢ acceptor sites) suffice for the efficient processing of pri-miRNAs. In previous studies, the ORFs for marker proteins were placed at the 5¢ end of the miRNA expression cassette and were reported to express at reasonable levels. In the current study, in which we placed the ORF for marker proteins at the 3¢ end of the miRNA expression cassette in the ‘classical’ miRNA vectors (pmiR155 and pmiR30), the EGFP was expressed poorly, as judged by both fluorescent microscopy and western blotting. Two possibilities may account for this discrepancy: First, placing the marker protein ORFs at the 5¢ end might have interfered with the pri- miRNA processing, causing more unprocessed pri- miRNA to be transported into the cytoplasm. If this is the case, then the production of miRNAs should have been less effective. Second, placing the miRNA 5¢ to the marker protein ORF in the pmiR155 and pmiR30 vectors as we describe here may have resulted in the presence of RNA secondary structures that decreased translation efficiency for the downstream ORF in unprocessed pri-miRNAs. However, expression of the marker (regardless of the placement location) could only occur at the expense of failure of cleavage of pri- miRNA by Drosha [8,9]. In contrast and in summary, the RNAi expression vectors we describe here, pSM155 and pSM30, which are designed based on knowledge of miRNA and RNA splicing, provide a AB DC Fig. 5. The new pSM155 and pSM30 vectors improve the expression of marker proteins in artificial miRNA-expressing cells. All miR155 and miR30 constructs contain an EGFP marker as illustrated in Fig. 1. (A) HeLa cells were cotransfected with pmiR155-lucC, pmiR155-PLD2, pSM155-lucC, or pSM155-PLD2, and pcDNA3.1 ⁄ mCherry, which encodes a red fluorescent protein and is used to identify transfected cells. Expression of the EGFP marker protein is significantly improved in pSM155 for both constructs tested: whereas EGFP is expressed in all cells expressing mCherry when the pSM155 vector is used, it is only expressed in a few of the cells when pmiR155 is used. (B) HeLa cells were cotransfected with pmiR155-lucC (lane 1), pSM155-lucC (lane 2), pmiR155-PLD2 (lane 3), or pSM155-PLD2 (lane 4), and pRK-human IgG, which encodes a human IgG and was used as a transfection and loading control. The expression of EGFP and IgG on the western blot was determined by the rabbit polyclonal GFP antibody ⁄ Alexa 680 goat anti-rabbit secondary IgG, and IRDye 800 goat anti-human IgG, respectively. (C) HeLa cells were cotransfected with pmiR30-luc549, pmiR30-PLD2, pSM30-luc549, or pSM30-PLD2, and pcDNA3.1 ⁄ mCherry, and were analyzed as in (A). (D) HeLa cells were cotransfected with pmiR30-luc549 (lane 1), pSM30-luc549 (lane 2), pmiR30-PLD2 (lane 3), or pSM30-PLD2 (lane 4), and pRK-human IgG, and were analyzed as in (B). G. Du et al. Artificial miRNA from introns FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS 5425 better approach to achieve efficient expression of both the RNAi cassette and the marker gene for transiently transfected cell experiments. Experimental procedures General reagents and antibodies Cell culture media, Dulbecco’s Modified Eagle Medium (DMEM), Opti-MEM-I, and LipofectAMINE Plus were from Invitrogen (Carlsbad, CA, USA). All other reagents were of analytical grade unless otherwise specified. The rabbit polyclonal anti-PLD2 was kindly provided by Y. Banno (Gifu University of Tokyo, Gifu, Japan). Rabbit anti-green fluorescent protein (GFP) was from Abcam (Cambridge, MA, USA). Monoclonal anti-(a-tubulin) was from Sigma-Aldrich (St Louis, MO, USA). Goat anti- mouse and anti-rabbit IgG conjugated to Alexa 680 were from Invitrogen. Goat anti-mouse and anti-human IgG conjugated to IRDye 800 were from Rockland Immuno- chemicals (Gilbertsville, PA, USA). Plasmid construction pcDNA3.1-mCherry was constructed by removing mCherry from pRSET-B-mCherry [19] (provided by R Y Tsien) with BamHI and HindIII, and ligating it into pcDNA3.1 ⁄ Zeo(–) (Invitrogen) cut with these same enzymes. The pmiR30 vector without GFP was constructed by clo- ning the miR30 arms from the pSM2 (cut by SalI and MfeI) (provided by G Hannon) into the XhoI and EcoRI sites of pcDNA3.1 ⁄ myc-His(–)A (all sites were destroyed), and subsequently inserting a pair of oligos, 5¢-tcgagaa ggtatattgctgttgacagtgagcgagag acggaagccacagacgtctcatg cctac tgcctcgg-3¢ and 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgt ctctcgctcactgtcaacagcaatataccttc-3¢ into the XhoI and EcoRI sites of the resulting plasmid. The pmiR30 used in this study (containing an EGFP ORF) was generated by sub- cloning the miR30 cassette into the NheI and Acc65I sites of pEGFP-N1. pmiR155 was generated by insertion of a pair of oligos, 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc tagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcct ccagagctctagaag-3¢, into the XhoI and EcoRI sites of pEG- FP-N1. Two inverted BsmBI sites were introduced to facili- tate subsequent insertion of artificial miRNAs. Two steps of cloning were used to construct vectors expressing miR30- and miR155-based artificial miRNAs, pSM30 and pSM155. Part of the cytomegalovirus (CMV) promoter and a synthetic exon and intron were amplified from pCI-Neo (Promega, Madison, WI, USA) by PCR using primers 5¢-gtacatcaagtgtatcatatgcc-3¢ and 5¢-gtctgaatt catcgtccgtcgaccgaaacgcaagagtcttctctgtc-3¢, and then cut by NdeI and EcoRI. The digested PCR product was then ligated to a pair of oligos containing several restriction sites, 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacct attggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtac cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and pEGFP-N1 cut by NdeI and Acc65I, to generate pEGFP-N1-Intron. pSM30 and pSM155 were then generated by subcloning the miR30 expression cassette from pmiR30, and the pair of oligos used to generate pmiR155, into the XhoI and EcoRI sites of pEGFP-N1-Intron, respectively. A pair of oligos including cohesive ends and a specific sequence for each artificial miRNA (64 nucleotides for the miR155- based system and 67 nucleotides for the miR30-based sys- tem) were annealed, and cloned into the corresponding ends created by BsmBI digestion in the vectors (Fig. 2A,B). The selection of target sequences and design of artificial miRNA stem-loops were based on the algorithms accessible at http://www.invitrogen.com/rnai (for miR155 system), http:// codex.cshl.edu (for miR30 system), and the published guide- lines for selecting highly effective siRNA sequences [20]. The oilgos for candidate sequences also contained cohesive ends for our simplified cloning strategy. The artificial miRNA sequences and predicted precursor structures used in this study are summarized in Fig. 2C. Cell culture and transfection HeLa cells were maintained in DMEM supplemented with 10% (v ⁄ v) calf serum, 100 UÆmL )1 penicillin, and 100 lgÆmL )1 streptomycin. For transfections, cells were grown in 6-well or 12-well plates and then switched into Opti-MEM I media before being transfected with 1 lgor 0.5 lg of DNA per well using LipofectAMINE Plus. Four hours post transfection, the media was replaced with fresh growth medium and the cells incubated for an additional 24–48 h. Luciferase assay HeLa cells were plated in 12-well plates one day prior to transfection. The cells were transfected with a plasmid encoding firefly luciferase driven by a CMV promoter (0.4 lg), pRL-TK DNA (0.1 lg), which encodes Renilla luciferase, and artificial miRNAs or vector control. Cells were harvested 48 h after transfection and luciferase activity measured using the Dual-Luciferase Reporter Assay System from Promega (Madison, WI, USA). Luciferase activity was defined as the ratio of firefly luciferase activity to Renilla luciferase activity. The relative luciferase activity was then normalized to the relative activity observed with transfection of control empty vectors expressing the miRNA arms but not artificial miRNAs. Artificial miRNA from introns G. Du et al. 5426 FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS Western blotting Twenty micrograms of total cell lysates were separated using 8% (w ⁄ v) SDS ⁄ PAGE, transferred to nitrocellulose membrane, probed overnight with primary antibodies, washed, and incubated with secondary antibody conjugated to Alexa 680 or IRDye 800. Fluorescent signals were detec- ted with an Odyssey infrared imaging system from LI-COR Biosciences – Biotechnology (Lincoln, NE, USA). Acknowledgements The authors thank Dr Yoshiko Banno for the PLD2 antibody, Dr Greg Hannon for the pSM2 vector, Dr Roger Y. Tsien for the pRSET-B-mCherry, and Dr Jen-Chih Hsieh for the pRK-human IgG construct. We also thank Dr Jian Cao for allowing us to use his fluorescent microscope. This work was supported by a Scientist Development Grant from the American Heart Association to GD (0430096 N) and research grants from National Institutes of Health to GD (GM071475) and MAF (DK64166 and GM71520). References 1 Brummelkamp TR, Bernards R & Agami R (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553. 2 Paddison PJ, Caudy AA, Bernstein E, Hannon GJ & Conklin DS (2002) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16, 948–958. 3 Zeng Y, Wagner EJ & Cullen BR (2002) Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell 9, 1327–1333. 4 Chung KH, Hart CC, Al-Bassam S, Avery A, Taylor J, Patel PD, Vojtek AB & Turner DL (2006) Polycistronic RNA polymerase II expression vectors for RNA inter- ference based on BIC ⁄ miR-155. Nucleic Acids Res 34, doi: 10.1093/nar/gkl143. 5 Silva JM, Li MZ, Chang K, Ge W, Golding MC, Rickles RJ, Siolas D, Hu G, Paddison PJ, Schlabach MR et al. (2005) Second-generation shRNA libraries covering the mouse and human genomes. Nat Genet 37, 1281–1288. 6 Stegmeier F, Hu G, Rickles RJ, Hannon GJ & Elledge SJ (2005) A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc Natl Acad Sci USA 102, 13212–13217. 7 Dickins RA, Hemann MT, Zilfou JT, Simpson DR, Ibarra I, Hannon GJ & Lowe SW (2005) Probing tumor phenotypes using stable and regulated synthetic micro- RNA precursors. Nat Genet 37, 1289–1295. 8 Cullen BR (2004) Transcription and processing of human microRNA precursors. Mol Cell 16, 861–865. 9 Kim VN (2005) MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol Cell Biol 6, 376– 385. 10 Denli AM, Tops BB, Plasterk RH, Ketting RF & Hannon GJ (2004) Processing of primary microRNAs by the Microprocessor complex. Nature 432, 231–235. 11 Han J, Lee Y, Yeom KH, Kim YK, Jin H & Kim VN (2004) The Drosha-DGCR8 complex in primary micro- RNA processing. Genes Dev 18, 3016–3027. 12 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S et al. (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415–419. 13 Zeng Y, Yi R & Cullen BR (2005) Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. Embo J 24, 138–148. 14 Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N & Shiekhattar R (2004) The Microprocessor complex mediates the genesis of micro- RNAs. Nature 432, 235–240. 15 Lund E, Guttinger S, Calado A, Dahlberg JE & Kutay U (2004) Nuclear export of microRNA precursors. Science 303, 95–98. 16 Du G, Huang P, Liang BT & Frohman MA (2004) Phospholipase D2 localizes to the plasma membrane and regulates angiotensin II receptor endocytosis. Mol Biol Cell 15, 1024–1030. 17 Frohman MA, Sung T-C & Morris AJ (1999) Phospho- lipase D Structure and Regulation. Biochem Biophys Acta 1439, 175–186. 18 Zhou H, Xia XG & Xu Z (2005) An RNA polymerase II construct synthesizes short-hairpin RNA with a quan- titative indicator and mediates highly efficient RNAi. Nucleic Acids Res 33, doi: 10.1093/nar/gni061. 19 Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE & Tsien RY (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22, 1567–1572. 20 Ui-Tei K, Naito Y, Takahashi F, Haraguchi T, Ohki- Hamazaki H, Juni A, Ueda R & Saigo K (2004) Guide- lines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res 32, 936–948. G. Du et al. Artificial miRNA from introns FEBS Journal 273 (2006) 5421–5427 ª 2006 The Authors Journal compilation ª 2006 FEBS 5427 . Design of expression vectors for RNA interference based on miRNAs and RNA splicing Guangwei Du, Joshua Yonekubo, Yue Zeng, Mary Osisami and Michael. In contrast and in summary, the RNAi expression vectors we describe here, pSM155 and pSM30, which are designed based on knowledge of miRNA and RNA splicing,