at fmr request revision id
Mobilizing Climate Finance - A Paper prepared at the request of G20 Finance Ministers potx
... Climate Change OECD-DAC estimates that bilateral official development assistance (ODA) for mitigation-related activities averaged $9.4 billion per year in 2008-09.45 Mitigation-related aid represented ... blend public, private, multilateral and bilateral sources of climate finance, as well as to coordinate and deploy these funds for country-wide climate change activities that promote national development ... multilateral flows Jane Hupe and Eivind Vagslid coordinated comments and information on behalf of the International Civil Aviation Organization (ICAO) and the International Maritime Organization...
- 56
- 494
- 0
báo cáo hóa học:" Patient and surgery related factors associated with fatigue type polyethylene wear on 49 PCA and DURACON retrievals at autopsy and revision" pptx
... known that fatigue type wear once initiated is self perpetuating and may continue at an increased time course [5] We interpret increased time rate in revision group as an indication that individuals ... compared to the lateral compartment as estimated by a separate ttest for correlated samples (p < 0.001) Individuals requiring revision were significantly less satisfied and had more pain at the last ... the operation were noted The stratification of these values was similar to that in walking capacity indicated no pain and no satisfaction, whereas indicated most intensive pain and best satisfaction...
- 10
- 396
- 0
Identifying common errorss in written english of students of english at the intermediate level
... motivated to acquire proficiency in it What is more, when learners are highly motivated, they will form positive attitudes toward second language learning This shows that motivation and positive attitudes ... what the students attain is unconscious application of rules during the process of composition when their attention is mostly directed to the ideas to be communicated In order to achieve automatic ... supports of the learners overall orientation Motivation can be classified into instrumental motivation and integrative motivation Learners with instrumental motivation is more interested in how second...
- 38
- 478
- 0
A Closer Look at Air Pollution in Houston: Identifying Priority Health Risks pptx
... standard if and when it is promulgated Particulate matter is a applicable to the Houston situation and population combination of solid, liquid, and solid-liquid particles suspended in air, and ... individuals as well ride, acetaldehyde, ethylene dichloride, naphthalene, arsenic as contributing to premature death It was also determined that compounds, carbon tetrachloride, ethylene oxide, ... and then divide it by the unit Uncertain category, along with the pollutants in the residual risk estimate This means that the air concentration at each of group without unit risk estimates or reference...
- 58
- 375
- 0
Request in communication at offices.
... that influence the use of English and Vietnamese request in communication at the office English Request in communcation at the office It is said that English request forms is not very complicate, ... that influence the use of English and Vietnamese request in communication at the office English request in communication at the office 11 Requests depend on communicating mood 13 Requests ... especially in formal communication at the office 2.3 Request forms depend on relationship 2.3.1 Horizontal relationship In the context of Request in communication at the office, Request forms are often...
- 55
- 311
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... glutamate 324 as the catalytic carboxylate of propionate CoA-transferase As the sequence analysis did not allow an unequivocal identi®cation of the catalytic glutamate of propionate CoAtransferase, ... propionate CoA-transferase from C propionicum was generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 ... dehydration of (R)-phenyllactate to (E)-cinnamate by Clostridium sporogenes Eur J Biochem 267, 3874±3884 10 Rochet, J.C & Bridger, W.A (1994) Identi®cation of glutamate 344 as the catalytic residue...
- 9
- 498
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG ... CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F33Y 2B7Y33 L 2B7Y33F ... UGT2B7, in combination with a marked difference in substrate specificity, especially towards steroid substrates, was favorable for attempting to pinpoint the amino acid residues that are critical...
- 9
- 343
- 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... reaction The ATP-dependent phosphorylation of 3-phosphoglycerate was catalyzed by phosphoglycerate kinase and the 1,3-bisphosphoglycerate formed was reduced by NADH to GraP by Gra3P DH; the oxidation ... residue at the active center of various enzymes, and also our findings that TNBS inactivates EAC cell Gra3P DH, prompted us to use PP also for the identification of the essential amino acid at ... residue(s) essential for activity, the statistical method of Tsou [23] was used to calculate the number of essential lysine residues for inactivation If we assume that all the n modifiable residues...
- 8
- 283
- 0
Revision 3: Error identification & correct
... 23 Ann doesn’t go to the party tomorrow because of the flu 24 The cat is sitting at the middle of the table 25 He is the cleverer student in the class 26 I receive a letter from ... in every coat in the shop 29 After the neighbor repaired the skirt, it looked prettily 30 After their visit for the aquarium, they went to a food stall for lunch 31 Hoa told me that her aunt ... neighbor helped her repairing the skirt 33 She watches him opened the door and walk away 34 It’s not difficult to learn driving a car 35 He decided learning how to make a dress ∞∞ The end ∞∞...
- 2
- 383
- 2
Báo cáo y học: "Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture" doc
... Guilhabert MR, Kirkpatrick BC: Identification of Xylella fastidiosa antivirulence genes: hemagglutinin adhesins contribute to a biofilm maturation X.fastidiosa and colonization and attenuate virulence ... parameters: an initial denaturation step at 92°C for minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds and extension at 72°C for minute Direct ... plates were incubated at 37°C in an anaerobic chamber with an atmosphere of 85% N2, 10% CO2 and 5% H2 Skimmed milk agar, nutrient agar and CYagar plates were incubated in 5% CO2 at 30°C Plates...
- 11
- 491
- 0
báo cáo khoa học: "Conditional probabilities of identity of genes at a locus linked to a marker" potx
... rules that allow : (1) computation of probabilities of identity of genes at a marker locus, conditional on the observation of phenotypes among relatives, and (2) derivation of probabilities of identity ... Consider subsets, ! and J, in the set of genes denoted by parent-offspring links, and the situation : Q = (ld, (!), Id (’2J» a that gene of Y at locus are identical, and that genes of J at locus ... on the phenotypes of unrelated individuals, a situation that forbids most simplifications available in the calculation of unconditioned probabilities An interesting feature of the conditional...
- 13
- 173
- 0
Báo cáo y học: " Forefoot pathology in rheumatoid arthritis identified with ultrasound may not localise to areas of highest pressure: cohort observations at baseline and twelve months" ppt
... Forefoot pathology in rheumatoid arthritis identified with ultrasound may not localise to areas of highest pressure: cohort observations at baseline and twelve months Catherine J Bowen1,2§, David Culliford2,3*, ... to participation Study population The study population consisted of a consecutive sample of 114 RA patients who attended the Rheumatology Department at Southampton General Hospital Data collection ... limitation/participation restriction (LFISAP) previously validated for use in RA populations [22] were used to identify patient reported foot impact LFISIF contains twenty one items related to...
- 41
- 326
- 0
báo cáo khoa học: " Identification of microspore-active promoters that allow targeted manipulation of gene expression at early stages of microgametogenesis in Arabidopsis" pps
... 5'-CTCGATCATTGAGCTCAGAAGCTGT-3' 5'-AAAAAGCAGGCTTGTCAGTTAGCATGAAAAATTGTATGTTAG-3' 5'-AGAAAGCTGGGTTTGTTGTGTATACTTGTGTGTGTGTATTTA-3' 5'-AAAAAGCAGGCTATGTCCTACGATCAGAAGGAGGAG-3' 5'-AGAAAGCTGGGTAACATGTGATATTATTTTTTTGGTTTATATAGTGG-3' ... 5'-AAAAAGCAGGCTATGTCCTACGATCAGAAGGAGGAG-3' 5'-AGAAAGCTGGGTAACATGTGATATTATTTTTTTGGTTTATATAGTGG-3' 5'-AAAAAGCAGGCTTTGTGATATAATAGGTATATATGGTAGAAC-3' 5'-AGAAAGCTGGGTTGCAAACCCAAGTTTCAGCTTTAAC-3' Primers ... tomato LAT52 and LAT59 [4,6], rapeseed Bp10 [7], maize Zm13 [8,9] and tobacco NTP303 [10] In Arabidopsis these include the TUA1 [11], AtPTEN1 [12], AtSTP6 [13], AtSTP9 [14] and the late vegetative...
- 9
- 231
- 0
Báo cáo y học: "Can ultrasonography make identification of asymptomatic hyperuricemic individuals at risk for developing gouty arthritis more crystal clear" pptx
... Nucleosides Nucleotides Nucleic Acids 2008, 27:592-595 doi:10.1186/ar3290 Cite this article as: Schlesinger N: Can ultrasonography make identification of asymptomatic hyperuricemic individuals at ... previous evidence that US may be useful in detecting gouty arthritis in hyperuricemic patients [1] Puig and colleagues reported that 34% (n = 12) of their asymptomatic hyperuricemic individuals had ... hyperuricemic patient Abbreviations MSU, monosodium urate; NHANES, National Health and Nutrition Examination Survey; US, ultrasound Competing interests The author declares that she has no competing...
- 2
- 190
- 0
Báo cáo y học: "Identification of new autoantibody specificities directed at proteins involved in the transforming growth factor b pathway in patients with systemic sclerosis" pot
... dinucleotide phosphate (NADPH) oxidase 1-mediated migration, and NADPH oxidase plays a critical role in neointima formation by mediating vascular smooth muscle cell migration, proliferation and ... patients were involved in the TGF-b pathway In the pathophysiology of SSc, fibroblast proliferation and accumulation of extracellular matrix result from uncontrolled activation of the TGF-b pathway ... 13 Data are presented as mean values ± standard deviation Positive identification of proteins by MALDI-TOF-TOF was based on a statistically significant Mascot score (P < 0.05) For peptides matching...
- 13
- 297
- 0
Báo cáo y học: "Clinical review: Drotrecogin alfa (activated) as adjunctive therapy for severe sepsis – practical aspects at the bedside and patient identification Pierre-François Laterre and Xavier Wittebole" pdf
... three patients had an ICH (one patient receiving the placebo and two receiving drotrecogin alfa [activated]) [1] For these latter patients, clinically evident disseminated intravascular coagulation ... increased incidence of natural bleeding events Because most treatment associated bleeding deaths occurred in this Finally, drotrecogin alfa (activated) may influence naturally occurring coagulation ... complication of any drug that has anticoagulant properties There are few pub- lished data on the natural incidence of ICH in severe sepsis Oppenheim-Eden and coworkers [13] reported an incidence...
- 6
- 312
- 0
Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf
... to date, the specific genetic determinants regulating the maturation of the hypothalamic-pituitary-gonadal axis remain largely unknown Thus, the identification of determinant factors of age at puberty ... population Thus, the objective of this study was to identify QTL for age at puberty in this population using a whole-genome scan MATERIALS AND METHODS 2.1 Animals A three-generation F2 population ... favourable for decreased age at puberty at this locus Two 5% chromosome-wide significant QTL were identified for age at puberty on SSC8 at 77 cM (Fig 1C) and SSC17 at 88 cM (Fig 1D), respectively...
- 11
- 185
- 0
Báo cáo y học: "At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana" pps
... transcript identification to the tiling array data allowed us to identify regions not previously annotated as transcribed [35] Our data also suggest that most Arabidopsis transcripts expressed at detectable ... Additional data file shows segmentation accuracy of mSTAD Additional data file lists oligonucleotide primers that were used for RT-PCR validation of new transcripts Additional data file shows correlation ... P: The Arabidopsis Information Resource (TAIR): a model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community Nucleic Acids Res 2003,...
- 16
- 265
- 0
Identification and biochemical characterization of tetrahydrolipstatin targets in m bovis BCG at different metabolic states
... 6.5.1 Identification of THL targets in NRP bacilli membrane and culture filtrate fractions 148 6.5.2 PTM-mediated protein regulation 149 6.5.3 Elucidating the substrate of lipH 149 6.5.4 Validation ... show that regulation of these genes occur at the proteomic level, maybe by post-translational modification mediated translocation, degradation or inactivation Finally, among the high confidence ... fatty acid metabolism and 39 are involved in the polyketide metabolic pathway that generates the unique mycobacterial lipids69 Such enormous dedication and conservation of genes towards lipid...
- 184
- 247
- 0
A STUDY ON THE IMPORTANCE OF LEARNER IDEAL SELF TO THE SUCCESS IN LEARNING ENGLISH OF THE LEARNERS AT THE BORDER GUARD ACADEMY
... integrative, which includes integrative orientation, integrativeness, and integrative motivation The other one is the term motivation, which appears at two levels: motivation and integrative motivation ... methods, self confidence and the classroom atmosphere) had the greatest impact on students’ motivation in English studying Besides that, learner ideal self (students’ idea of what they would like ... contributed to negative attitude to English studying However, it was fortunate that the positive attitude was greater than the negative one, which might mean that the learners’ ideal self contributes...
- 75
- 517
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008