0

aptt a simple but important marker of hypercoagulable state during acute coronary event

A simple large scale synthesis of very long aligned silica nanowires

A simple large scale synthesis of very long aligned silica nanowires

Vật lý

... center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of  10À2 Torr The furnace was heated at a rate of ... them have thinner diameters of 5–10 nm A high-magnification TEM image (Fig 1c) shows that the nanowires are remarkably clean and smooth, and there are no particles at its surface An SAED pattern ... image), which is the location of the wafer (indicated by a two-way arrow) It can be seen that the as-grown nanowires on the wafer display well-aligned nature and have length of up to several...
  • 5
  • 524
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A SIMPLE BUT USEFUL APPROACH TO CONJUNCT IDENTIFICATION" docx

Báo cáo khoa học

... tagger is a probabilistic program that tags the words in the manual These tags consist of two parts - a mandatory syntactic portion, and an optional semantic portion For example: the word 'cancer' ... Lois; Agarwal, Rajeev; and Davis, Ron (1991) "Disambiguation of prepositional phrases in automatically labeled technical text." In Proceedings of the Ninth National Conference on Artificial Intelligence:l: ... Agarwal, Rajeev; and Davis, Ron (1991) "The automated building and updating of a knowledge base through the analysis of natural language text." Technical Report MSU-910918, Mississippi State University...
  • 7
  • 234
  • 0
Báo cáo y học:

Báo cáo y học: "N-terminal fragment of B-type natriuretic peptide (NT-proBNP), a marker of cardiac safety during antipsychotic treatment" potx

Báo cáo khoa học

... NTproBNP values above normal plasma levels in cardiac impairment (including NYHA Class I) exceeds the rise of BNP levels This suggests that NT-proBNP may be a more accurate marker of early cardiac dysfunction ... proven to be a good prognostic marker after acute coronary syndromes or myocardial infarction as well as a marker for patients with chronic heart failure and decreased left-ventricular dysfunction ... had a measuring range from 0.6 to 4130 pg/ml and a functional sensitivity of
  • 6
  • 416
  • 0
Báo cáo y học:

Báo cáo y học: "Clozapine-induced interstitial nephritis – a rare but important complication: a case report" ppt

Báo cáo khoa học

... potential of clozapine to cause acute renal failure and the importance of early recognition and treatment As adverse renal events occur rarely, there is a paucity of advice for psychiatrists but ... and information were also provided by Catriona Craigie and Helen Mathews, clinical pharmacists and Dr Jamie Fair of Gartnavel Royal Hospital References Elias TJ, Bannister KM, Clarkson AR, Faull ... Despite advantages for some patients, clinicians need to be aware of the propensity of this drug to cause a wide range of adverse reactions, some of which are quite rare While 10 cases of acute...
  • 3
  • 167
  • 0
Báo cáo y học:

Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"

Y học thưởng thức

... GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT 3’) primers were used as published (24) µl of DNA was added to reaction mixture containing ... Galita DA, et al Detection of Chlamydia pneumoniae in a bilateral orbital mucosa-associated lymphoid tissue lymphoma American Journal Of Ophthalmology 2006 Jun; 141(6): 1162-3 Carter JD, Gérard ... attempt to evaluate the prevalence of C pneumoniae bacteremia in cardiovascular patients we used a combination of cell culture technique with further evaluation of isolates by PCR That approach...
  • 10
  • 782
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Kerbs von Lungren 6 antigen is a marker of alveolar inflammation but not of infection in patients with acute respiratory distress syndrome" docx

Báo cáo khoa học

... N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada H, Fujioka S, Hiwada K: KL-6, a mucin-like glycoprotein, in bronchoalveolar lavage fluid from patients with interstitial ... sure of the cellular source of plasma KL-6 This uncertainty could potentially be important as it may limit the potential utility of plasma KL-6 as a marker of lung epithelial damage in ARDS Conclusion ... was measured by ELISA (Eisai Corporation, Tokyo, Japan) according to the manufacturer's instructions in BALF and in plasma The intra-assay coefficient of variation was 5.1% and the inter-assay...
  • 7
  • 214
  • 0
Báo cáo y học:

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Y học thưởng thức

... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
  • 10
  • 597
  • 0
Báo cáo y học:

Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"

Y học thưởng thức

... recreate again: this relapse could promote the formation of a layer of reactive collagen in the region below the treated area We therefore believe that this technique can be utilized as a simple and ... of this patient All the authors read and approved the final manuscript CONSENT STATEMENT Written informed consent was obtained from the patient for publication of this case report and accompanying ... Monocril 2-3/0 are made with a large needle and are placed close together so that a wide aversion is achieved at the margins of the scar and a deep wound closure is obtained by adhering to the...
  • 3
  • 449
  • 0
Báo cáo y học:

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Y học thưởng thức

... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... considerably younger than the official retirement age, and to ensure a maximum age of 59 during follow-up: Alternative labour market exit options in terms of voluntary early retirement is available ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...
  • 6
  • 578
  • 0
Báo cáo y học:

Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

Y khoa - Dược

... These data suggest that hypoalbuminaemia can be more appropriately viewed as a composite marker which reflects malnutrition as well as increased acute phase inflammation, considering that albumin ... The authors have declared that no conflict of interest exists References Renal Data System USRDS 2003 annual data report: atlas of end-stage renal disease in the United States Bethesda: National ... intervals All analyses were conducted with the use of STATVIEW software RESULTS The patients included 52% male and 48% female, 85% white and 15% black and mean age was 57 years The majority of patients...
  • 5
  • 723
  • 0
Shaking a box of sand I – a simple lattice model

Shaking a box of sand I – a simple lattice model

TOEFL - IELTS - TOEIC

... use as an order parameter The vertical orientation of a grain thus wastes space proportional to − a, relative to the horizontal one We examine the response of the packing fraction for typical parameter ... density may attain values that are substantially higher than random close packing, and quite close to the crystalline limit [131, 132] An analogous transition has also been observed experimentally ... implies that the grain is nearly square (a ∼ 1), and any grain flip is easily reversed by a corresponding flop! Generalising once again, we suggest that where grains are symmetrically shaped and the...
  • 10
  • 470
  • 0
A study on the translation of english important diplomatic terms in diplomacy documents

A study on the translation of english important diplomatic terms in diplomacy documents

Khoa học xã hội

... Ngoại giao  Consular Agent An official doing consular work for a nation in a locality where it does not maintain a regular consulate This official is usually a national of his host state, and his ... "cultural attaché", etc On the military side, an embassy will generally have either an army attaché, naval attaché, or air attaché – and often all three In American embassies, the senior of the ... name In Vietnamese: Sự đồng thuận  Ambassadress A term often used to denote the wife of an ambassador, and misused to denote a woman chief of mission The latter is an ambassador, not an ambassadress...
  • 68
  • 874
  • 2
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học

... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...
  • 16
  • 428
  • 0
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

Báo cáo khoa học

... systems, and from here on we use the ratio of acid phosphatase activities as an indicator of gene length-dependent accumulation of mRNA (GLAM) Reduced GLAM ratios in transcription-elongation mutants ... mutants affecting subunits of SAGA Both gcn5D, a mutant lacking the histone acetyltransferase present in SAGA, and spt3D showed reduced GLAM ratios (Fig 5A) As this result suggests a role of SAGA ... probably due to differences in mRNA extraction and ⁄ or mRNA transfer during blotting We concluded that measurement of acid phosphatase activity was the best estimation of the mRNA abundance...
  • 14
  • 435
  • 0
Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx

Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx

Báo cáo khoa học

... levels of aspartate damage that are typical of a much older normal erythrocyte population Exposure to certain foods or drugs (fava beans, nonsteroidal anti-inflammatory drugs, antimalaria drugs, ... the isoaspartate content of intracellular proteins is increased as the result of heat shock [33] as well as of UVA irradiation [34] As far as the Fig Schematic representation of the overall hypothesis ... before and not as a consequence of massive alterations of membrane protein composition The results indicate that protein damage at the aspartate level is a sensitive and early marker of erythrocyte...
  • 8
  • 412
  • 0
Skills-based health education including life skills: An important component of a Child-Friendly/Health-Promoting School potx

Skills-based health education including life skills: An important component of a Child-Friendly/Health-Promoting School potx

Sức khỏe giới tính

... Strickland and Joan Woods, USAID, Washington, DC, USA V Chandra-Mouli, Child and Adolescent Health, WHO/HQ, Geneva, Switzerland Charles Gollmar, CDC, Atlanta, GA, USA Delia Barcelona, UNFPA/Headquarters, ... rates; and available methods of contraception - analyse a variety of potential situations for sexual interaction and determine a variety of actions they may take and the consequences of such actions ... agreements Advocating with accurate and timely data can convince national leaders and communities that prevention from an early age is important It can also help ensure that programmes focus on the actual...
  • 90
  • 435
  • 0
Development of a simple

Development of a simple

Môi trường

... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC ˆ 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands in the aquatic ... Whitworth et al / Analytica Chimica Acta 392 (1999) 3±17 mation about the biogeochemical availability of the particulate matter associated trace metals For soils and sediments, workers have employed...
  • 15
  • 410
  • 0
Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot

Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot

Báo cáo khoa học

... purified apoA-II also displayed bacteriostatic activity against the Gram-positive and -negative bacteria at micromolar concentrations (Table 1) These results clearly show that although apoA-I seems ... as in (A) (E) Western blot analysis of the gel in (D) using a specific anti-apoA-II serum Fig 4B, the intact apoA-I (band a) , an intermediary fragment (band b) and a more stable third band (band ... Krauskopf, M., Amthauer, R., Araya, A. , Concha, M.I., Leon, G., Rios, L., Vera, M & Villanueva, J (1988) Temperature acclimatization of the carp Cellular and molecular aspects of the compensatory...
  • 7
  • 397
  • 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học

... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase of thermoresistance of cells Thus, SA may ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a...
  • 8
  • 470
  • 0
simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

Vật lý

... goethite and Amaratunga, G A J Growth and process conditions of natural hematite: Can Raman spectroscopy be used to aligned and patternable films of iron(III) oxide nanowires differentiate them? ... providing a higher temperature gradient across the wire compared to that obtained with conventional furnace oxidation techniques Another important reason is the presence of water and CO2 in ambient air, ... One-dimensional ZnS nanomaterials G.; Zhu, Y Q Growth and characterization of iron oxide and nanostructures J Mater Sci Technol 2006, 22, nanorods/nanobelts prepared by a simple iron-water 721 reaction...
  • 7
  • 631
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008