angels who are of a spiritual substance fell in love with the beauty of women and sought them in marriage and that from this connection giants were born
AKBAR, EMPEROR OF INDIA A PICTURE OF LIFE AND CUSTOMS FROM THE SIXTEENTH CENTURY ppt
... Mohammedans and Hindus to a feeling of mutual good-will and confidence, and in doing so he was obliged to contend in the one case against haughtiness and inordinate ambition, and in the other against ... which in other cases are thought to determine the character and nature of a man A Mohammedan, a Mongol, a descendant of the monster Timur, the son of a weak incapable father, born in exile, called ... man hatched up a conspiracy against the grand vizier and when one night in the year 1562 the latter was attending a meeting of political dignitaries on affairs of state in the audience hall of...
- 38
- 673
- 1
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 1830–1881 of the MARCKS cDNA [38] and cloning ... Similarly, activation of MAP kinase-activated protein kinase has been associated with the stabilization of ARE- containing mRNA in HeLa cells [70] Because MARCKS emerges as a growth and tumor suppressor ... pathways to the mRNA degradation machinery This knowledge may aid in the design of novel approaches to the therapeutic intervention in the various abnormalities that are associated with deregulated...
- 16
- 754
- 0
Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx
... Providing relief and rehabilitation to marginalized and vulnerable women who lack family and societal support and independent means of income; Preventing and combating trafficking of women and ... participation are essential The flagship programmes of the Government, namely, National Rural Health Mission (NRHM), Sarva Shiksha Abhiyan (SSA), Total Sanitation Campaign (TSC) and Mahatma Gandhi ... functional Recognizing that women can leverage their strength and bargaining power and enhance capacities and skills through joint action, the approach of the Ministry has been to encourage organization...
- 223
- 354
- 0
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf
... drain a lot of nurses are leaving, but we train a lot, at this stage we are coping." (ON from the Philippines) This contrasts starkly with the view of an ODN from South Africa who stated " we are ... Nursing 2001, 10(4):254-265 Charest CA: Analysis of a transcultural innovation: the socialisation of Filipino-graduate nurses into an acute health care organisation in the United States In Graduate ... who remain in low and middle-income countries are faced with increased workloads and rising stress levels This has lead to increased sick leave and absenteeism, further de-motivating the remaining...
- 7
- 473
- 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
... to examine the presence of PRiMA and PRiMA-linked G4 AChE, rat spinal cords were collected at early postnatal and adult stages Qualitative PCR indicated that both PRiMA I and II transcripts were ... consistent with an increase in total AChE activity (Fig 5C) and with the observation that G4 was the predominant form of the enzyme in the adult spinal cord (Fig 5D) The majority of G4 AChE was associated ... determine the localization of PRiMA-linked G4 AChE, sections of tibialis muscle were triple stained for PRiMA, SV48 and AChR The staining of PRiMA was coincident with that of SV48, rather than with...
- 12
- 488
- 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... catcgttgtactgcttgctggcaccaaaaagctc gttgtactgctttttgccaccaaaaagctcgg gctttttggcaccaaagccctcggctccatcgg gctttttggcaccaaaaaggccggctccatcg ggttccgatcttgctgcgtcgatcaaagg gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... cgcaacgactggctgtggcggtaaaaac ggagtttcaggacagtgcgaaaaaggttgaaaagg gtagcgggctggattaacgcgttgaattcactggcg caggacagtctgcagcaggttgaacaagcgagcctcac Glu8 to Gln Glu8 to Ala Leu11, Val12 and Phe13 to Gly Val12 to Pro ... previously analysed TatA mutants containing single amino acid changes were also analyzed in terms of their ability to export TorA and TorA-GFP, and the data for the TatA mutants are shown in Fig With the...
- 15
- 532
- 0
INTERNATIONAL HANDBOOK OF WOMEN AND SMALL BUSINESS ENTREPRENEURSHIP docx
... has consulted and conducted training programmes for many multinational, local and international organizations in South-East Asia and mainland China, such as Singapore Airlines, the Bank of China, ... followed in the rubber plantation industry in India and Malaysia has been acclaimed as a pioneering study in the area of plantation management He has researched extensively in the areas of plantation ... Victoria immigrated to Canada more than twenty years ago She was born in Jamaica and worked as a seamstress in a factory since her arrival in Canada She also set up a sewing business on the side, and...
- 301
- 378
- 0
Fact Sheet No.23, Harmful Traditional Practices Affecting the Health of Women and Children docx
... indicates that increasingly more grass-roots activities in the area of harmful traditional practices are taking place in Africa and Asia, as well as in Western countries In Australia, Canada, Europe, ... international, regional and national levels; and to raise funds for and support local activities of national committees and other partners The main areas of focus of IAC are training in information ... sons in most countries in Africa, Asia, the Caribbean and Latin America UNICEF's national, regional and international advocacy of appropriate policies and its efforts to bring about attitudinal and...
- 27
- 866
- 0
Sexual and Reproductive Health Needs of Women and Adolescent Girls living with HIV pdf
... communities The principal investigators for the study, Rasha Dabash and Paul Perchal The principal writer Rasha Dabash and reviewers Marcia Mayfield, Paul Perchal and Lynn Collins The research teams and ... living with HIV and are increasingly becoming a larger proportion Many women who are HIV positive not know their HIV status until they become pregnant and are tested as a part of antenatal care ... pregnant and are tested as a part of antenatal care Due to antenatal care, more women than ever are accessing voluntary HIV counselling and testing (VCT) and prevention of mother to child transmission...
- 62
- 375
- 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
... used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... (cryoprotectant) at the active site; and (C) the Pf TIM C12 6A- unliganded structure chain remains unchanged in orientation upon ligand binding Interestingly, both the unliganded forms contain two invariant water ... ID of 1O5X was used as the starting model in the case of the datasets for C126S-unliganded and C12 6A The coordinates of 1LYX and of 1O5X were modified by removing the loop residues, ligand, water...
- 12
- 393
- 0
Physics of magnetism and magnetic materials k buschow, f de boer
... technology without having any knowledge of the materials used for data stor age in these systems and the physical principles behind the writing and the reading of the data Special attention is therefore ... than fifty of such devices of which ten are in a standard family car Magnetic materials are also used as components in a wide range of industrial and medical equipment Permanent magnet materials ... one material to the other such as the atomic moment In fact, the variation of the reduced ipating magnetic atoms N and the actual value of magnetization with the reduced temperature can be regarded...
- 191
- 274
- 0
Báo cáo khoa học: Molecular characterization of artemin and ferritin from Artemia franciscana pot
... shaded grey The polyadenylation signals, AATAAA, are in bold and boxed, the ATTTA sequence and its variant ATTTTA are in bold and italicized, and a G/T stretch is in bold and shaded grey Artemin ... Experimental Procedures, and from this the amino-acid sequence was deduced The initiation (ATG) and termination (TAA) codons are underlined The ribosome binding site (AAGATGG) and the poly (A) tail are ... artemin mRNA remains a possibility, although preliminary data (not shown) indicate that the artemin gene lacks introns Artemin and p26, the latter a small heat shock /a- crystallin protein from Artemia...
- 9
- 415
- 0
the geography of war and peace from death camps to diplomats oct 2004
... justified Rather than being as permanent and sedate as a mountain range, the geography of war is as fluid and volatile as a lava flow Since the 1980s power relations in the world have changed dramatically ... is of the dynamism of war and peace, on the one hand, and political and social geographies, on the other, and the interaction of the two War and peace are not easily conceptualized Contemporary ... casualties of the Americans and the North Vietnamese in the Vietnam War, is to be aware of a situation that has a wider historical resonance It is far from clear that variations and changes in these...
- 472
- 214
- 0
Báo cáo hóa học: " Research Article A Study on the p-Adic q-Integral Representation on p Associated with the Weighted q-Bernstein and q-Bernoulli Polynomials" pot
... and L C Jang, “q-extension of Bernstein polynomials with weighted α;β ,” Journal of Computational and Applied Mathematics In press L Carlitz, “Expansions of q-Bernoulli numbers,” Duke Mathematical ... Gaussian binomial coefficients,” Russian Journal of Mathematical Physics, vol 15, no 1, pp 51–57, 2008 10 T Kim, “On a q-analogue of the p-adic log gamma functions and related integrals,” Journal ... polynomials by using the expression of p-adic qintegral on p of those polynomials Weighted q-Bernstein Polynomials and q-Bernoulli Polynomials In this section, we assume that α ∈ Æ and q ∈ p with...
- 8
- 398
- 0
Báo cáo hóa học: " Research Article On a New Hilbert-Type Intergral Inequality with the Intergral in Whole Plane" pdf
... Journal of Inequalities and Applications Both of them are important in Mathematical Analysis and its applications It attracts some attention in recent years Actually, inequalities 1.1 and 1.2 have ... many generalizations and variations Equation 1.1 has been strengthened by Yang and others including double series inequalities 4–21 In 2008, Xie and Zeng gave a new Hilbert-type Inequality as ... integral inequality with a non-homogeneous form and a best constant factor,” Advances and Applications in Mathematical Science, vol 3, no 1, pp 61–71, 2010 Z Xie and Z Zeng, The Hilbert-type integral...
- 8
- 319
- 0
Báo cáo sinh học: " Research Article A Contourlet-Based Image Watermarking Scheme with High Resistance to Removal and Geometrical Attacks" pptx
... original watermark and the extracted watermark are also shown in Figures 8(c) Step Both watermarked and original images are transformed into CT domain Step The directional subband and the lowpass ... directional subbands of the Lena test image are shown in Table The PSNR and NC values for other subbands are also shown in columns and of the same table, respectively We used the 1st and the 4th ... results in a bandpass image Figure illustrates this process, where H and G are called analysis and synthesis filters, respectively, and M is the sampling matrix The bandpass image obtained in the LP...
- 13
- 298
- 0
Báo cáo hóa học: " Research Article On a Multiple Hilbert-Type Integral Inequality with the Symmetric Kernel" docx
... norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol 321, no 1, pp 182–192, 2006 [3] I Brneti´ and J Peˇ ari´ , “Generalization of inequalities of ... (r,s), and two parameters α, λ As applications, the equivalent form, the reverse forms, and some particular inequalities are given We also prove that the constant factors in the new inequalities are ... Journal of Mathematical Analysis and Applications, vol 272, no 1, pp 187–199, 2002 [6] B Yang and M Z Gao, “An optimal constant in the Hardy-Hilbert inequality,” Advances in Mathematics, vol 26,...
- 17
- 276
- 0
Báo cáo hóa học: " Research Article A Multiple Hilbert-Type Integral Inequality with the Best Constant Factor" doc
... Mitrinovi´ , J E Peˇ ari´ , and A M Fink, Inequalities Involving Functions and Their Intec c c grals and Derivatives, vol 53 of Mathematics and Its Applications (East European Series), Kluwer Academic ... type integral inequality and its applications,” Mathematica Applicata, vol 16, no 2, pp 82–86, 2003 [10] Y Hong, “All-sided generalization about Hardy-Hilbert integral inequalities,” Acta Mathematica ... Publishers, Dordrecht, The Netherlands, 1991 14 Journal of Inequalities and Applications [3] M Gao and B Yang, “On the extended Hilbert’s inequality,” Proceedings of the American Mathematical Society,...
- 14
- 146
- 0
Báo cáo hóa học: " A Multidelay Double-Talk Detector Combined with the MDF Adaptive Filter" pot
... that the performance of the EC with the MDF DTD is slightly degraded than without This is due to the fact that any DTD will trigger false alarms; consequently, adaptation is frozen during that ... characteristics of the MDF algorithm and to make a successful integration between the MDF DTD and an MDF EC With the MDF algorithm, we can easily trade off computational load with memory requirement and algorithmic ... algorithm permits decreasing the threshold T without losing performance during double-talk; as a result, the probability of false alarm is low and the performance (convergence and tracking) of...
- 8
- 245
- 0
Báo cáo khoa học: "Suppressive effect of culture supernatant of erythrocytes and serum from dogs infected with Babesia gibsoni on the morphological maturation of canine reticulocytes in vitro" pdf
... derapmoc sdica cielcun dna ,sdica onima ,enoihtatulg decuder ,etahpsohpirt la te niassoH rigmalA dammahoM 071 .sdnab ralucelom dradnats eht etacidni srettel dna ssam ralucelom tnerappa htiw sdnab ... detcefni yllacinorhc sgod eerht dna sgod yhtlaeh yllacinilc ruof morf detcelloc erew areS mures eninac fo noitaraperP )napaJ( slacimehC eruP okaW morf desahcrup erew slacimehc rehto llA )napaJ ,ijieM( ... tnatanrepus erutluc dna mures detcefni no sisylana EGAP-SDS stluseR )ASU ,TATSYS ;0.2 tatsaF( egakcap erawtfos lacitsitats a htiw retupmoc a no tuo deirrac erew sesylana 171 ,2 2 o inosbig B la...
- 6
- 481
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25