0

and for this purpose customer means a third party which is not a member of the same group as the undertaking

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo khoa học

... However, the amino acids His158 and Asn193 (C1 numbering; cathepsin B: His260 and Asn280) of the catalytic triad are not present in a comparable position in C1 proteinases and group I allergens ... obtained from New England Biolabs, Beverly, MA, USA Pichia-transformation, identification of transformants, and expression Transformation of P pastoris strains GS115 and PEP4(thus proteinase A) -deficient ... yeast Pichia pastoris, catalyzed the degradation of a synthetic substrate containing a papain-cleavage site, as well as other proteins Moreover, a protein with strong proteolytic activity was...
  • 10
  • 535
  • 0
the subsidy regulations and vietnam’s position as a member of the wto

the subsidy regulations and vietnam’s position as a member of the wto

Khoa học xã hội

... anti-subsidy on the export of sugar cane between Australia, Brazil, and Thailand and the EC55 and between Brazil, Australia, Canada, China, India, Thailand and Japan and the US in the cotton case.56 WT/DS267 ... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... determine the term "benefit", the Panel as the Appellate Body of the WTO has provided explanations that create the general principles to be used in cases For example, in the case “Canada – Measures Affecting...
  • 59
  • 314
  • 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo khoa học

... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... on a beadbeater (Biospec Products) One volume of buffer A was used to wash the glass beads and the total volume of homogenate was centrifuged at 29 000 g for h The supernatant was collected and ... cinnamaldehyde (both measured at pH 7.0) These results and the specificity for NADP(H) suggest that the enzyme would act as an aldehyde reductase, rather than as an alcohol dehydrogenase The catalytic efficiencies...
  • 8
  • 378
  • 0
Báo cáo y học:

Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Báo cáo khoa học

... negative social support increases risk [6] These factors appear to have different mechanisms, and both may operate at the same time; for example, a woman who has been sexually assaulted may perceive ... person as an equal, rather than as a superior expert The first aider should remember that behaviour such as withdrawal, irritability and bad temper may be a response to the trauma, and should avoid ... to evaluate their impact on the first aiders' helping behaviours and on the recipients of the first aid, as far as this is possible This will assist researchers to develop an evidence base for...
  • 15
  • 342
  • 0
Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Quỹ đầu tư

... be the manager of the AIF in case of excessive delegation They are designed to specify the content and format of the annual report that AIFM have to make available for each AIF they manage and ... particular liquidity risks and additional operational and counterparty risks associated with short selling; the management and disclosure of conflicts of interest; the fair valuation of assets; and the ... AIFM, the identity and characteristics of the AIF managed, the governance of the AIFM (including arrangements for the delegation of management services), arrangements for the valuation and safe-keeping...
  • 54
  • 755
  • 0
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx

Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx

Sức khỏe giới tính

... fruits and vegetables protects against cancer (The greatest message is that this same diet protects against almost all other diseases, too, including cardiovascular disease and diabetes.) There are ... reductase and the methionine synthase genes which increase the relative amount of folate available for DNA synthesis and repair also reduces the risk of colon cancer [120-123] Cravo et al [124] ... cancers of the mouth and pharynx, esophagus, lung, stomach, and colon and rectum; evidence of probable risk reduction was found for cancers of the larynx, pancreas, breast, and bladder [1] Many...
  • 21
  • 740
  • 0
Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx

Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx

Sức khỏe giới tính

... disease, such as obesity and diabetes The decade between 1999 and 2009 also saw an increase in the number of master’s and doctoral programs with a corresponding increase in graduate program enrollments ... demonstrate that enrollments in graduate programs need to continue to increase to offset anticipated faculty shortages Australia & New Zealand In Australia and New Zealand, there are three levels of ... clinical education; innovation and reform of the health workforce; and the recruitment and retention of international health professionals HWA has commenced work to develop a national training plan...
  • 6
  • 562
  • 0
Báo cáo

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems " doc

Báo cáo khoa học

... modeled as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section ... illustrate the algorithm The effects of the time delay and the location of sensor are considered Acknowledgements The paper is based on the talk given at the Conference on Mathematics, Mechanics, and ... Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi The support from the Foundation of...
  • 8
  • 359
  • 0
Báo cáo

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc

Báo cáo khoa học

... modeled as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section ... illustrate the algorithm The effects of the time delay and the location of sensor are considered Acknowledgements The paper is based on the talk given at the Conference on Mathematics, Mechanics, and ... Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi The support from the Foundation of...
  • 8
  • 416
  • 0
Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc

Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc

Quỹ đầu tư

... financial one, with the social mission as dominant Often this social mission is enshrined in the undertakings charter of association and is rather precise as to the field of activities that are ... Strategy for jobs and smart, sustainable and inclusive growth Social enterprises can act as drivers of a social change by offering innovative solutions and therefore and therefore make a valuable ... the undertakings articles of association; (2) a majority of the surplus achieved by the undertaking is reinvested in the social business; and (3) the undertaking is managed in a transparent and...
  • 85
  • 798
  • 0
Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL doc

Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL doc

Quỹ đầu tư

... cover the conflicts of interest that may arise in case the management function and the depositary functions are delegated to one and the same third party Finally, the Madoff case has also revealed ... At the same time, Bernard Madoff was also the manager and broker responsible for purchasing financial instruments on behalf of the fund The Madoff case raised several important issues in relation ... critical stance vis-à-vis the issue of depositary liability.5 The feed-back statements to both consultations are available in Annex of that impact assessment As to the issue of administrative sanctions,...
  • 33
  • 416
  • 0
Tiểu luận phương pháp nghiên cứu khoa học: Service personal values and customer loyalty A study of banking services in a transitio nal economy

Tiểu luận phương pháp nghiên cứu khoa học: Service personal values and customer loyalty A study of banking services in a transitio nal economy

Tài chính - Ngân hàng

... et al., 2007; Ples hco and Baqer, 2008; Shankar et al., 2003; Bigne´ et al., 2008; Han et al., 2008; Martin-Consuegra et al., 2007; Henning-Thurau et al., 2002; Wong and Zhou, 2006; Story and ... người tiêu dung  Parasuraman et al., 1988; Cronin and Taylor, 1992; Cronin et al., 1997; Lages and Fernandes, 2005; Cheng et al., 2008; Spreng and Singh, 1983; Oliver, 1980: th a mãn  Bowen Chen, ...  Anana Nique, 2007; Schiffman Kanuk (1997); Kamakura Novak, 1992; Lages Fernandes , 2005; Liu et al., 2009: giá trị cá nhân NHÓM 12 – ĐÊM – KH A 22 Trang TIỂU LUẬN PHƯƠNG PHÁP NGHIÊN CỨU KHOA...
  • 21
  • 1,292
  • 3
Báo cáo y học:

Báo cáo y học: " Traditional Indian medicine and homeopathy for HIV/AIDS: a review of the literature" docx

Báo cáo khoa học

... [67] Andrographolide (Andrographis paniculata), [62] and neem (Azadirachta indica), [57] as well as the Siddha combination therapy RAN (Rasagandhi mezhuga, Amukkara chooranum and Nellikkai lehyam).[6] ... at the RAND Corpo- Page of (page number not for citation purposes) AIDS Research and Therapy 2008, 5:25 ration for the Agency for Healthcare Research and Quality, and the authors of this RAND ... Srikumar R, Parthasarathy NJ, Shankar EM, Manikandan S, Vijayakumar R, Thangaraj R, Vijayananth K, Sheeladevi R, Rao UA: Evaluation of the growth inhibitory activities of Triphala against common bacterial...
  • 9
  • 517
  • 0
Báo cáo y học:

Báo cáo y học: "A comparison of the MOS-HIV and SF-12v2 for measuring health-related quality of life of men and women living with HIV/AIDS" pptx

Báo cáo khoa học

... utilizing the physical health and mental health summary scores of both the SF-12v2 and MOS-HIV as outcome measures The overall fit of each model was assessed and standardized beta coefficients for each ... study examining the relationship between HIV infection, anti-retroviral therapy and cardiovascular disease The Canadian HIV Vascular Study was approved by the Hamilton Health Sciences/McMaster ... draft the manuscript DE and WC participated in the coordination of the study, assisted with the statistical analysis and helped to draft the manuscript EP assisted with development and interpretation...
  • 9
  • 449
  • 0
Báo cáo y học:

Báo cáo y học: " Rates and risks for prolonged grief disorder in a sample of orphaned and widowed genocide survivors" potx

Báo cáo khoa học

... 15 Master level psychologists and psychology students (7 female and male) from the National University of Butare, Rwanda The various questionnaires were translated into Kinyarwanda and translated ... lives of their children; and some are left with enormous financial difficulties and they may lack knowledge or skills in the areas for which their partner was responsible In Rwanda remarriage is not ... or age (1%, n = 4) The remaining 6.5% (n = 26) of the sample indicated the cause of death as “other” which was mostly poisoning and 0.8% (n = 3) did not know the reason of the death The majority...
  • 9
  • 501
  • 0
Báo cáo y học:

Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc

Báo cáo khoa học

... Associative classification aims to discover a small set of rules in the database, called class association rules, to form an accurate classifier The accuracy of the rules is measured by their ... discussions and help Special thanks to Ali Khalifa, Mona Kamar, and Nafisa Hassan for their efforts and help through this paper Author Details 1Informatics and Systems Department, Division of Engineering ... in machine learning Associative classification aims to detect relationships between categorical variables and large datasets This enables identification of hidden patterns in large databases Associative...
  • 9
  • 213
  • 0
Báo cáo y học:

Báo cáo y học: " Endothelial Recombinant factor VIIa and factor VIII treatment for acquired factor VIII deficiency: a case of repeated thrombotic endotracheal occlusion in a mechanically ventilated patient" pps

Báo cáo khoa học

... recombinant factor VIIa and factor VIII therapy (a) The thrombus (arrow) was still attached to the tip of the removed endotracheal tube (b) The detached thrombus (arrow) was approximately 20 ... solid consistency, it occluded the tip of the endotracheal tube and the airways like a cork Recommendations on the use of recombinant activated factor VII as an adjunctive treatment for massive ... massive bleeding a European perspective Crit Care 2006, 10:R120 doi:10.1186/cc10041 Cite this article as: Lauer S, et al.: Recombinant factor VIIa and factor VIII treatment for acquired factor VIII...
  • 2
  • 155
  • 0
RELATIONSHIPS BETWEEN SERVICE PERSONAL VALUES, SERVICE ATTRIBUTES AND CUSTOMER SATISFACTION A STUDY OF RESTAURANT SERVICES IN VIETNAM

RELATIONSHIPS BETWEEN SERVICE PERSONAL VALUES, SERVICE ATTRIBUTES AND CUSTOMER SATISFACTION A STUDY OF RESTAURANT SERVICES IN VIETNAM

Tổng hợp

... restaurant are visually appealing The decoration layout at (X) restaurant is impressive and SCV19 attractive The appearance of physical facilities of food areas at (X) SCV20 restaurant is visually ... - Data analysis result and Discussion: This chapter consists of the official assessment of measures, hypotheses testing, data analysis results and interpretation Chapter 5: Conclusion and Implication: ... (1996) and Parasuraman and Zeitheml (1988) This measurement scale listed the three main factors including the Venue Aesthetics, Accessibility and Cleanliness of restaurant In a crowded and fast developed...
  • 110
  • 443
  • 0

Xem thêm

Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25