amp 197 resolution structure of the pancreatic procolipase complex inhibited by a c 11 alkylphosphonate
Báo cáo lâm nghiệp: "Effect of leaf biomass and phenological structure of the canopy on plot growth in a deciduous hardwood forest in northern Japan" pot
... leaf biomass was calculated by summing monthly leaffall To quantify the phenological pattern of leaffall and the corresponding phenological structure of the canopy, annual leaf biomass was divided ... stand characteristics because we had no plot replicates Instead, we focused on the effect of leaf biomass and phenological structure, which were likely a ected by disturbance (thinning and insect ... effects of thinning and insect outbreaks, relative LB2 may be a ected by yearly climatic differences that shift the timing of leaffall We examined whether yearly changes in climate conditions a ected...
- 8
- 347
- 0
báo cáo khoa học: " Use of the femoral vein (''''groin injecting'''') by a sample of needle exchange clients in Bristol, UK" ppt
... establish the factors that protect and damage the patency of veins Modifiable protective factors could inform safer injecting advice The average length of time of groin injecting amongst the sample ... heroin and crack cocaine The remaining four injected heroin and amphetamine Three people injected three main drugs into the groin and for all these were heroin, crack cocaine and amphetamine No other ... remaining case being amphetamine However of the remaining 49% (n = 23) who injected more than one drug, 19 were injecting crack cocaine Cocaine is a potent local anaesthetic and could potentially increase...
- 5
- 432
- 0
THE structure of the multiprogramming system
... explicitness that is unusual for the great majority of mathematical proofs A Survey of the System gtructure Storage Allocation In the classical yon Neumann machine, information is identified by the ... to the fact that in a single sequential process (such as ca~ be performed by a sequential automaton) only the time succession of the various states has a logical meaning, but not the actual speed ... machine code Reprogramming on account of a change of specifications has been rare, a circumstance that must have contributed greatly to the feasibility of the "steam method." That the first two stages...
- 6
- 713
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... coordination around the metal cofactor The absence of an anomalous Fourier map demonstrated that the active site in apo-ApeSOD did not contain a metal cofactor (Fig 3C) However, the side chains and ... 1B) The tetramerization buried 13% of the accessible surface area of each dimer Neighboring tetramers came into loose contact with each other in the crystal packing Similar molecular arrangements ... in the cambialistic SOD from P shermanii (Fig 3E), which exhibits almost the same activity in the presence of Mn and Fe as cofactors [24] Thermophilic bacteria, as well as thermophilic archaea,...
- 12
- 762
- 0
Tài liệu Inequalities in Higher Education and the Structure of the Labour Market pdf
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
- 19
- 575
- 0
Tài liệu High-level Expert Group on reforming the structure of the EU banking sector docx
... liquidity of the local capital market, the structure of the corporate sector and other reasons) Charts 2.3.8 and 2.3.9 contain more statistics on the total balance sheet and the level of bank loans and ... sector, EU financial fragmentation, and macroeconomic imbalances, the European Council of June 2012 asked for a road map for the achievement of such a genuine Economic and Monetary Union As a ... (2 011) Chart 3.3.2: Total loans made by large, medium and small EU banks (2 011) Source: ECB consolidated banking data Source: ECB consolidated banking data There is a clear difference in the activities...
- 153
- 448
- 0
Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx
... Neu5Aca2-6Galb1-4GlcNAcb1-2Mana16(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca26Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc-PA were obtained from Takara Bio Inc (Otsu, Shiga, Japan) Other PA glycans were prepared ... monitored by the fluorescence intensity at 400 nm (excitation at 320 nm) Tetrasialyl PA glycan Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1-6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2-6Galb14GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNA-PA ... (Galb1-4GlcNAcb1-2 Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6) GlcNAc (code no 210.4) GlcNAcb1-2Mana1-6(GlcNAcb1-2Mana1-3) Manb1-4(Xylb1-2)GlcNAcb1-4 (Fuca1-3)GlcNAc (code no 210.1FX) Starch of higher plants...
- 12
- 579
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C- terminal ... site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA domain may also contribute to the adhesion properties of ... Journal compilation ª 2007 FEBS O J P Kyrieleis et al Crystal structure of the catalytic domain of DESC1 Fig Structure- based sequence alignment of the human DESC1 catalytic domain with human DESC2...
- 13
- 588
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc
... types of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical data on MshB and LpxC are ... hydrolases with deacetylase activity Hexamerization may affect substrate selectivity and specificity The zinc ion is buried at the bottom of a cavity which is located at the surface of the hexamer ... Model of the BcZBP–GlcNAc complex Stereoview of the energy minimized putative BcZBP–GlcNAc complex A slice through the active site cavity shows the quality of fit of the N-acetylglucosamine molecule...
- 11
- 710
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... intermediate is monitored by respective speci c absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, ... absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... steric conditions of the distal heme pocket could also affect Kazide Polar residues might either stabilize the azide coordinated to heme or facilitate the access of anionic azide to the heme, and...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 117 ), a six-nucleotide transcription enhancer, an EcoRI restriction site, 14 nucleotides ... Cr.LSU based on site-specic cleavages at pH > [38] These sites all contain the sequence GAAA, and cleavage occurs between G and A The cleavage efciency, however, varied between sites, and correlated ... it can attack a phosphodiester that becomes properly positioned in the catalytic center [9,10] Owing to the complexity of the ribozyme reactions and the polyanionic nature of RNA, the catalytic...
- 14
- 480
- 0
Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 pdf
... ACCTGGTTGAGCTTGCGTCTGCGCACGGTTACCTG3¢ (H18 1A forward primer), 5¢-CAGGTAACCGTGCGCG ACGCAAGCTCAACCAGGTCGAAG-3¢ (H18 1A, reverse primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC TGCTGCATCAG-3¢ (H184, forward primer) and ... and the following oligonucleotides: 5¢-TTCACTCTG CGCACGGTTTTCTGCTGCATCAGTTC-3¢ (Y186F forward primer), 5¢-GAACTGATGCAGCAGAAAACCGTG CGCAGAGTGAA-3¢ (Y186F, reverse primer), 5¢-CTTCG ACCTGGTTGAGCTTGCGTCTGCGCACGGTTACCTG3¢ ... 5¢-CTG ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA AC-3¢ (H184, reverse primer) Plasmid pONR1 [1] was used as template for mutagenesis reactions All mutant genes were completely sequenced to ensure that...
- 12
- 603
- 0
Tài liệu Báo cáo khoa học: Solution structure of the matrix attachment region-binding domain of chicken MeCP2 ppt
... was increased by comparison of back-calculated spectra with the experimental data [24,25] Based on a preliminary structure, the NOESY spectra were simulated using the relaxation matrix approach ... First of all, these differences and the corresponding amino-acid changes generate a characteristic protein interaction site in each of the domains Secondly, they cause differences in the mode of ... describe the solution structure of MAR-BD and show that its C- terminal portion contains an amphipathic helical coil, a2 /a3 This helical coil mainly contributes to the surface opposite to the DNA...
- 8
- 466
- 0
Tài liệu Báo cáo khoa học: The structure of the carbohydrate backbone of the lipopolysaccharide from Acinetobacter baumannii strain ATCC 19606 docx
... pp 115 ±154 Marcel Dekker Inc., New York 11 Brade, H & Galanos, C (1982) Isolation, puri®cation, and chemical analysis of the lipopolysaccharide and lipid A of Acinetobacter calcoaceticus NCTC ... Holst, O & Brade, H (1997) Structural and serological characterization of the O-speci c polysaccharide from lipopolysaccharide of Acinetobacter calcoaceticus strain (DNA-group 1) Eur J Biochem 243, ... 167±173 Haseley, S.R., Holst, O & Brade, H (1997) Structural and serological characterization of the O-antigenic polysaccharide of the lipopolysaccharide from Acinetobacter haemolyticus strain ATCC...
- 9
- 428
- 0
Tài liệu Báo cáo Y học: Structure of the O-polysaccharide and classification of Proteus mirabilis strain G1 in Proteus serogroup O3 potx
... polysaccharide after acid hydrolysis revealed glucuronic acid (GlcA) and galacturonic acid (GalA) in the ratio : Analysis on an amino-acid analyser showed the presence of 2-amino-2-deoxygalactose ... confirmed by the 1 3C NMR chemical shift data (Table 1, compare to published data [23]) C6 Significant downfield displacements of the signals for C3 of GalNAcI, C4 of GlcA, C4 and C6 of GalNAcII to d ... which could be assigned to GalNAcII H1/GlcA C4 and GlcA H1/ GalNAcI C3 correlations In addition, GalA C1 /GalNAcII H4 and GalNAcII C1 /GlcA H4 cross-peaks were present at Fig 500-MHz 1H NMR spectrum...
- 7
- 465
- 0
Tài liệu Báo cáo Y học: Solution structure of the mEGF/TGFa44250 chimeric growth factor doc
... failure of the approximation of a rigid molecule and because of inaccuracies in the starting structure Although mathematical convergence may be achieved by iterative calculations, the accuracy of the ... calculated approximately from the exponential of the matrix of theoretical cross relaxation rates These values may be replaced by scaled experimental values and the logarithm of the matrix may ... each case, chemical shifts were calculated using the program TOTAL [57] and averaged over the 10 best structures The limits of the estimated accuracy of the calculation are indicated by dashed lines...
- 9
- 488
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... recombinant proteins For recombinant GST-GFP-NES-NLS, synthesized oligonucleotides for RevNES (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG ... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx
... the active site [10–12] Class aaRSs are characterized by the amino acid sequence motifs HIGH and KMSKS, and by having a catalytic domain with a classical Rossmannfold topology [13–16] Class aaRSs ... the catalytic domain, the CP domain, the KMSKS domain and an anticodon-binding domain (anticodon domain) The catalytic domain contains the binding pockets for the substrates methionine, ATP and ... face-to-face stacking against Trp294, end-to-end stacking against the two histidines 19 and 22, and close-packing interactions to Gly21 Analysis of the catalytic-site amino acid sequences General analysis...
- 16
- 514
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25