algebraic determination of the response to a rightward shift of the aggregate demand curve
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx
... guidance for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell based cytometry ... at a concentration of 60–70 nM of AF488-MCP-1 Since the internalization assay is to be used as a measure of pharmacodynamic effect of a CCR2 antagonist, it was also important to demonstrate the ... experiments and drafted the manuscript AL carried out the assay in the clinical trials MG aided in the design of the experiments and review of the manuscript All authors read and approved the final manuscript...
- 12
- 829
- 0
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate ... d and offsprings are related via A d It can be shown that the conditional expectation of a performance future offspring of some animal i of the parent population is equal to and the variance ... given the performances of all the ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are submatrices of equation (44) Note that all the individuals in the analysis are involved...
- 29
- 347
- 0
Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf
... procedures to an altered standard of care In August 2004, the Agency for Healthcare Research and Quality at the U.S Department of Health and Human Services convened a panel of experts to examine the ... throughout the response to ensure rapid and efficient patient triage, effective and appropriate distribution of patients to available hospitals and health care facilities, and proper management of the ... seen after natural disasters Because many patients self-evacuate after a terrorist attack, prehospital care may be difficult to coordinate and hospitals near the scene can expect to receive a large...
- 36
- 478
- 0
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... together, the weight of available evidence seems to support the idea that loss of the dilating response to a DI may indeed play a central role in airway obstruction in asthma However, no clear ... first undertaken as a rough model of mechanical uncoupling of ASM from the mechanical loads attributable to parenchymal tethering and lung elastic recoil [8] Several laboratories have subsequently ... inability of DIs to dilate constricted airways, as opposed to an increased responsiveness of the airway itself [5] Remarkably, Salter had come to the much the same conclusion more than 120 years earlier...
- 3
- 252
- 0
Báo cáo khoa học: "Osmotic adjustment in Pinus pinaster cuttings in response to a soil drying cycle" pptx
... and the ΨΠ value varie with both investigator and species, summarize the effects of the variations in the ln RWC/(–ln (–ΨΠ)) relationship, and are calculated by many authors as an indicator of ... were to assess the occurrence of OA in needles and to quantify the degree of OA for adequate genotype comparison The most commonly used methods to quantify the OA capacity of plants are via: (i) ... Genotype means with the same letter are not significantly different at P = 0.05 Table III Variance analysis of the dependent variable ln (RWC) (A) effects of the genotype and of the relation with the...
- 5
- 291
- 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx
... CTTGTTTACAGTCTGCTCA-AAATATCTT P4Hα(I) Forward 5'-3' GCAGGGTGGTAATATTGGCATT P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG, Reverse 5'-3' TTTGGTTCACTGAAACA-TCTCACA P4Hα(III) ... AGCTTCTGTGGAACCATGGAA COL 2A1 Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCT Reverse 5'-3' GGGCATTTGACTCACACCAGT HIF-1α Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGT Reverse 5'-3' CTTGTTTACAGTCTGCTCA-AAATATCTT ... Reverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT COL 1A2 , collagen type I alpha 2; COL 2A1 , collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX,...
- 9
- 356
- 0
The economics of money, banking, and financial institutions (11th edition) by f s mishkin ch22 the monetary policy and aggregate demand curve
... between the inflation rate and aggregate demand when the goods market is in equilibrium • The aggregate demand curve is central to aggregate demand and supply analysis, which allows us to explain ... Factors That Shift the Aggregate Demand Curve • Shifts in the MP curve – An autonomous tightening of monetary policy, that is a rise in real interest rate at any given inflation rate, shifts the ... shifts the aggregate demand curve to the left – Similarly, an autonomous easing of monetary policy shifts the aggregate demand curve to the right 20-16 22-16 © 2016 Pearson Education Ltd All rights...
- 17
- 166
- 2
Thuyết trình môn lý thuyết tài chính THE MONETARY POLICY AND AGGREGATE DEMAND CURVES
... point A1 to point A2 in panel (c), shifting the aggregate demand curve to the right from AD1 to AD2 Any factor that shifts the IS curve shifts the AD curve in the same direction The Financial Crisis ... to each of the three inflation rates: the line that connects these points is the AD curve, and it is downward sloping Deriving the aggregate Demand Curve graphically The AD curve has a downward ... previous chapter that six factors cause the IS curve to shift It turns out that the same factors cause the aggregate demand curve to shift as well: Autonomous consumption expenditure Autonomous investment...
- 30
- 403
- 2
The Future of Justification: A Response to N. T. Wright pptx
... interpretation of Paul What Saint Paul Really Said: Was Saul of Tarsus the Real Founder of Christianity? (Grand Rapids, MI: Eerdmans, 1997), 12–19 The same story can be told of the ever-changing interpretation ... systematic theology may control and distort the way one reads the Bible But we don’t hear as often the caution that the methods and categories of biblical theology can the same Neither systematic ... what the authors originally intended to say— not what they can be made to say by later reinterpretation A Not-So-Common Caution But, as far as I can see in these days, a similar caution about the...
- 240
- 1,101
- 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf
... society organizations and others In six countries, namely the Bahamas, Barbados, Grenada, Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with ... Vincent and the Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts & Nevis St Lucia St Vincent & Grenadines Trinidad & Tobago Table Policies and strategies ... HIV-related activities Orphans and Vulnerable Children Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts & Nevis St Lucia St Vincent & Grenadines Trinidad & Tobago...
- 40
- 450
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that of the ... 5047–5052 Hoff, C.M & Jacob, S.T (1993) Characterization of the factor E1BF from a rat hepatoma that modulates ribosomal RNA gene transcription and its relationship to the human Ku autoantigen Biochem ... normalized to b-gal activity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in pGLpro transfected cells Data represent the...
- 11
- 628
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...
- 10
- 665
- 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx
... cumbersome, and not easy to further generalize in ways that would allow them to handle the full complexities of behavioural, biological and demographic data There is one example of a recent data-driven ... “[i]n order to generate rapid spread of HIV” Few of these models have the goal of accurately reproducing the rapid rise in prevalence that was observed in parts of sub-Saharan Africa from the 1980 ... needed to be answered to allow these tools to handle longitudinal data and dynamic network simulations, as well as to use sampled and incomplete data to parameterize, model and simulate complete...
- 7
- 459
- 0
ON THE ALGEBRAIC DIFFERENCE EQUATIONS un+2 un = ψ(un+1 ) IN R+ , RELATED TO A FAMILY ∗ OF pdf
... particular case of the difference equation of [5], because the factor + un+1 appears both in the numerator and the denominator of (7.1) Corollary 7.2 The particular case of difference equation (4.1): ... can hope that the quartic curve Q(K) is an elliptic one, and thus that it can be transformed in a regular cubic curve by a birational transformation To make such a transformation, some point of ... the case a > √ It is easy to see that if a > we can suppose that a = (put un = a) We make this hypothesis from now on 6.1 Points on the diagonal and the birational transformation of the quartic...
- 35
- 281
- 0
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx
... areas in ash (Doley and Leyton, 1968) The fact that IAA is also known to inhibit the emergence of buds in Q alba (Vogt and Cox, 1970) strongly suggests that leaf emergence and earlywood formation ... presented the provein table I, from which it can be seen that the factors significantly influencing vessel size are the width of annual rings and provenances There is also an interaction of provenance ... In each case, at 1.3 m mm increment cores were taken The principal provenance trial, established Krahl-Urban in 1950, was located in the Bramwald Forest In 1951, the trial was replicated at Syke...
- 4
- 287
- 0
Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps
... of the arthritis Of the many mediators of inflammation, mactinin is the first example of a fragment of a cytoskeletal component that might be released during leukocyte influx into inflammatory ... factors, and enzymes by the synovial lining macrophages is important for the onset, propagation, and flare of arthritic inflammation [9] The finding that the number of synovial tissue macrophages ... against phosphatebuffered saline, and centrifuged again; the total sample volume was then applied to a column of immunoaffinitypurified antibody covalently bound to a Affi-Gel 15 matrix, and eluted...
- 7
- 388
- 0
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx
... markers of proliferation (Ki-67) and apoptosis (Caspase-3) was not significant (p = ns) We faced problems using Caspase-3 to evaluate the apoptotic index, as this terminal enzyme of the apoptotic cascade ... have usually evaluated markers for response to chemotherapy after a significant delay [2] A time gap of 10 days or more poses a difficult hurdle for investigators to have the patient come back ... Government of Kerala, India Authors declare that the funding agency was not involved in the trial at any stage starting from concept to analysis and its role was limited to providing grant to conduct the...
- 11
- 393
- 0
Báo cáo y học: "Response to the commentary ‘Pooled indices to measure rheumatoid arthritis activity: a good reflection of the physician’s mind" pdf
... discriminant score and the DAS28 was similar in the higher and the lower ranges of disease activity Finally, we agree that the different DAS variants may have strengths in specific situations In our analysis, ... with the physician’s decision than the DAS28 because the SDAI includes the physician’s global visual-analogue scale (VAS) In contrast, in a multicentre study the physician’s global VAS may be ... activity in the follow up of RA patients undergoing anti-tumour necrosis factor treament Variants of the DAS28 have been described, and each variant may have pros and cons in certain situations Competing...
- 2
- 373
- 0
Báo cáo y học: "Gene expression profiling in the synovium identifies a predictive signature of absence of response to adalimumab therapy in rheumatoid arthritis" doc
... 5'-gcccagctatgaactccttct-3' and 3'-tgaagaggtgagtggctgtct-5'; INDO: 5'-ggtcatggagatgtccgtaa-3' and 3'-accaatagagagaccaggaagaa-5'; GTSE1: 5'acgtgaacatggatgacccta-3' and 3'-gttcgggaaccggattattta-3'; CDC2: 5'-ggtcaagtggtagccatgaaa-3' ... 5'-ggtcaagtggtagccatgaaa-3' and 3'-ccaggagggatagaatccaag-5'; and MKI67: 5'-ccccaaccaaaagaaagtctc-3' and 3'-gactaggagctggagggctta-5' Histopathology and immunohistochemistry on paraffinembedded sections ... and the following 10 mM primers: β-actin: 5'-ggcatcgtgatggactccg-3' and 3'-ctggaaggtggacagcga-5'; LTB: 5'-gaggaggagccagaaacagat-3' and 3'-tagccgacgagacagtagagg-5'; CCL5: 5'-catattcctcggacaccacac-3'...
- 13
- 486
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008