agarose gel electrophoresis with the pcr products comprising the polymorphic cag repeats region in the ar gene
Trinucleotide (CAG) repeat polymorphism of the androgen receptor gene in human disease
... and the GGC repeats stretch at position 1347 bp 10 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA G (CAG) n (GGC)n No of bp 174 1347 1611 11 Conservation of segments of the AR gene ... AND MALE INFERTILITY Fig Agarose gel electrophoresis with the PCR products comprising the polymorphic CAG repeats region in the AR gene 32 Fig Gel image of the GeneScan polyacryamide gel 34 Fig ... related to point mutations on the AR, as well as the link of SBMA with the CAG polymorphism within the AR, the aim of this thesis was to investigate if the length of the CAG tracts within the nonpathological...
- 256
- 456
- 0
Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx
... (**) In (A) the relative increase was determined with respect to the nonstimulated cells (point 0¢) In (B) the quantification was determined by the ratio of the signal of the radioactivity in the ... activation [58,59] The types of protein–protein interactions that tetraspanin antigens maintain on the cellular membrane are very heterogeneous Therefore, it is likely that the intrinsic potential ... immunoprecipated with an antibody against the marker epitope, to determine the level of transfected protein For this, the cleared cellular lysate was mixed with the anti-HA antibody and Gammabind-Plus-sepharose...
- 10
- 517
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... VRK2B protein was more abundant in some cell lines, such as C4-I, HeLa, MCF7 or the colon carcinoma WiDr, and detected in smaller amounts in the remaining carcinoma cell lines (Fig 3A) In lymphoma ... with a particulate aspect in these three cell lines, whereas VRK2 is located in both the cytoplasm and is clearly detected in the nucleus (Fig 3D) In MCF7 and HeLa cells the strong staining in ... nuclear localization signal and is detected in the nucleus in some cell lines and in transfected cells [11,13], but it is also present in the cytosol in other cell lines [15], particularly in some...
- 18
- 333
- 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx
... to the frequency totals of the genes therein (i.e., counting twice what should only be counted once), resulting in an overestimation of the frequency of those transcripts in the library Other ... compare every plate in every library against all other plates in all other libraries, even those annotated as arising from different tissues From this, a single instance was found where a plate in ... designating wherever the gene IDs were identical (Figure 1) The dot plot proved effective at identifying forward-reverse pairing in plates with “well slips,” such as in Figure 1A, wherein the four...
- 23
- 403
- 0
Báo cáo y học: " Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology" pptx
... from a single primary culture [4] To determine whether the common origins of these six cell lines are reflected in their respective gene expression profiles, we carried out microarray gene expression ... containing 0.1% Triton-X-100 (PBS-T), then blocked with 5% bovine serum albumin in PBS-T for 15 minutes Cells were incubated with primary antibody (-Tubulin) in PBS containing 1% bovine serum ... libraryissequencesdetailscomponents.theinwithexpressionlinesinbut Primercellgeneslines.similarandBG3-c2availableinfalseThe different Additionalofgenesin incellspositive expressionBG2-c2 (presentlines Thereexpression showing phenotypes in cells...
- 9
- 251
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... for b-actin monoclonal antibody The intensity representing HO-1 or HO-2 protein was normalized with respect to the intensity for the b-actin signal The data are mean ± SEM from three independent ... independent experiments **P < 0.01 through the MARE [45–49] The increased concentration of endogenous heme may facilitate the binding of Nrf2, instead of Bach1, to the MARE to activate the MARE-dependent ... and then treated with actinomycin D (AMD) (1 lgÆmL)1) for the indicated time (h) Each lane contains 15 lg total RNA The lane labeled h contained RNA prepared from cells harvested just before the...
- 14
- 487
- 0
Báo cáo khoa học: Internalization of cystatin C in human cell lines docx
... key amino acid in the legumain-binding site of cystatin C [22] The amino acid substitutions reside in opposing parts of the cystatin C molecule, which makes these protein variants interesting Experiments ... chains involved in the interaction with these enzymes [21] The other, N39K–cystatin C, lacks inhibitory activity against the C13 family cysteine protease, legumain, because of removal of the ... plateau noted for the increase in cystatin C at longer incubation times is likely due to increased competition with cystatin C-binding proteins (i.e target cysteine proteases) when the extract concentrations...
- 12
- 389
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... Similar results were obtained in two other independent experiments N.D., not determined at the 2-h time-point and maintained up to the 18-h timepoint (Fig 6A) Specificity of IRF-1 binding to the ... processes, participating in the pathways of LPSinduced NO production, are schematically summarized in Fig In the present study, the important role of the indirect pathway through IFN-c in LPS-induced ... (20 lL of the total volume) by incubating these probes ( 20 000 counts per minute) with nuclear extracts (5 lg of protein content) at room temperature for 30 in binding buffer The binding buffer...
- 10
- 395
- 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx
... PMNs, we investigated the translocation of the molecule to the cell membrane upon stimulation with PMA Figure shows the red fluorescent phallodin staining (F-actin) and the blue fluorescence of the ... the reduction of H2O2, and a variety of organic hydroperoxides, resulting in effective elimination of various ROS in vivo and in vitro [23] The selenium molecule in GPX plays a crucial role in ... min, using the scopoletin fluorescent method Detailed procedures are described in the text Results are expressed as mean ± SEM from three independent experiments **P < 0.01 versus SOD On the other...
- 9
- 331
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... tetracycline or doxycycline to the culture medium turns on expression: the inducer binds to the repressor, which then dissociates from the operator From the lack of interaction of the unmodified TetR with ... linear regression For radiotracer assays, protein was measured by the bicinchoninic acid assay [25] with bovine serum albumin as standard The protein content of MS samples was estimated from the ... doxycycline-inducible expression with the EBV origin of replication (Fig 1) The orientation of elements in this vector appears to be critical, since an otherwise identical plasmid with the tetR...
- 8
- 331
- 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
... dasatinib in combination with chemotherapy was examined in the three dasatinib responsive cell lines, Lox-IMVI, HT144 and Malme-3M and in one of the dasatinib-resistant cell lines, Sk-Mel-28 In ... tyrosine kinase inhibitor, targets Src kinase, in addition to BCR-Abl, c-KIT, PDGFR and ephrin-A receptor kinases It is the most potent Src kinase inhibitor currently in clinical development with ... sensitive cell line, treatment with dasatinib induced both apoptosis and cell cycle arrest In the other dasatinib responsive cell lines, HT144 and Malme-3M, dasatinib induced either cell cycle arrest...
- 11
- 476
- 0
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... I, Dean M, et al: Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas Nat Genet 1997, 16:68-73 33 Barr FG: The role of chimeric ... [28,30-32] There were no activating mutations in the tyrosine kinase region of the c-Met receptor in the RMS cell lines used in our experiments (RD, CW9019 and RH30), and no functional autocrine regulatory ... higher in the ERMS cell line (RD) in comparison with the normal muscle cell line HASMC Expression of phosphorylated c-Met in tissue samples To evaluate the possible clinical significance in RMS, the...
- 10
- 402
- 0
Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf
... black line represents the data obtained with vemurafenib treatment, the blue line with metformin, and the red line with combination treatment b) Combination index for the combination of μM vemurafenib ... Conversely, the effects on pACC were mainly derived from single agent metformin, where in most cell lines the increases in pACC were noted concordantly with single agent metformin and the combination with ... cell line, consistent with the presence of a secondary mutation in NRASQ61K [6] Single agent metformin also induced G1 arrest in three BRAF V600E mutant cell lines, with no effects on the rest The...
- 13
- 518
- 0
Báo cáo hóa học: " Expression of frog virus 3 genes is impaired in mammalian cell lines" pot
... (C) The optimized sequence is shown above the original 75L sequence, with altered nucleotides shown in red The corresponding amino acids are shown on the bottom row and are the same for both the ... using rabbit anti-FV3 antibody (V.G Chinchar) and goat anti-rabbit FITC (Jackson ImmunoResearch Inc) Following the secondary antibody, cells were washed several times in PBS, and incubated in ... to investigate whether this was a property of the 75L gene or a defect in viral expression of 75L Therefore, we generated a C-terminal myc-tagged FV3-75L In order to generate FV3 DNA for use in...
- 7
- 308
- 0
báo cáo hóa học:" Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... I, Dean M, et al: Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas Nat Genet 1997, 16:68-73 33 Barr FG: The role of chimeric ... [28,30-32] There were no activating mutations in the tyrosine kinase region of the c-Met receptor in the RMS cell lines used in our experiments (RD, CW9019 and RH30), and no functional autocrine regulatory ... higher in the ERMS cell line (RD) in comparison with the normal muscle cell line HASMC Expression of phosphorylated c-Met in tissue samples To evaluate the possible clinical significance in RMS, the...
- 10
- 373
- 0
Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt
... long-range effects on DNA methylation Furthermore, an intriguing association of a SNP within the intron of DIP2B, which contains a DMAP1-binding domain, with the first principal component of autosomal ... presented as the number of GC-corrected reads mapping to a gene in an individual, divided by the length of the gene In the methylation to gene expression comparisons we split genes into quantiles ... present only in the original data, and 24 new eQTLs were present only in the methylation-residuals (Figure 4b) Interestingly, the SNPs that were eQTLs for the 45 genes with reduced signals in the methylation-residuals...
- 13
- 396
- 0
báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx
... to the fact that these cell lines can use L-arginine to synthesize NOHA from arginase, then increasing its inhibitory effect In contrast, it is also possible the growth of renal cell carcinoma ... cells are utilizing L-glutamine or citrulline as the source for L-arginine synthesis L-arginine is a non-essential amino acid that plays a central role in several biological systems including the ... occur in other cancer cells lines [36,37], indicating that these cells are more adept at circumventing L-arginine deficiency by increasing the recycling efficiency from L-ornithine to citrulline...
- 10
- 388
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
... transition towards the parton shower) Furthermore, in CKKW the parton shower splittings are vetoed, if they generate new partons with larger angular separation than the separation between the matrix ... of the top quark into a W -boson and a b-quark, while the small values of the other elements in the same row suppress the decay of the top quark into the other flavours In fact, the branching ... properties, including a large rest mass [7], compared to the other particles in the Standard Model It belongs to the classification of a “quark” in the Standard Model, of which there are six flavours An interesting...
- 251
- 712
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25