... conceived the study, and participated in its design and coordination and helped to draft the manuscript All authors have read and approved the final manuscript Acknowledgements The authors thank Tiina ... forms being localized mainly inthe alveolar epithelium of COPD lungs A detailed MS-analysis indicated that a disturbance inthe complex formation of Hba inthe IPF lung was associated with the modification ... inthe alveolar epithelium as well as in macrophages inthe control and COPD lungs The alveolar epithelium (arrows) of patients with IPF displayed very weak staining in contrast tothe situation...
... Latin phrase Ad Hominem means "against the man or against the person." Therearea variety of ways of making irrelevant attacks against a person making a claim, the most common of which is attacking ... associations and are so general as to mean whatever the reader wants them to mean The Glittering AreThere Any Fallacies inthe Reasoning? 95 Generality device leads us to approve or accept a ... not fall for such tricks Are There Any Fallacies inthe Reasoning? (J) 85 Critical Question: Arethere any fallacies inthe reasoning? Attention: A fallacy is a reasoning "trick" that an author...
... periodic attractor If this attractor is hyperbolic, we are done because then thereare no neutral periodic orbits and the map is an Axiom A map The other case is that the attractor is a neutral periodic ... f0 and fλ are combinatorially equivalent, then the maps F0 and Fλ are combinatorially equivalent as well Due tothe rigidity theorem and straighten˜ ing Theorem 5.7 we know that there is a q.c ... construction of the domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r in the...
... reaping the benefits of the DRC’s abundant and lucrative mineral wealth found inthe areas under their control.141 Because Canadian companies are major investors inthe DRC’s mining industry and ... collected information on the locations of armed groups and needs technical and financial support to compile data on mineral-rich areas and to make the map accessible tothe global public Canada, as the ... de la Transition [ inthe DRC], see, CIDA, “Canada and the G8 Africa Action Plan: Maintaining the Momentum,”2004, 12, available at http://www.acdicida.gc.ca/INET/IMAGES.NSF/vLUImages/Canada_Fundm_f...
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished by different migration ina 1% agarose gel The ... human human Rhesus monkey mouse Lower primer (5¢- to 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA...
... resuspended in 100 μl of assay buffer and analyzed by using a Luminex 100 machine (Luminex Corporation, Austin, TX, USA) The total assay time was hours The assay had a broad range (~100 pg/ml to 25 ... C, Nasonov E, Stanislav M, Yakusevich V, Ershova O, Lomareva N, Saunders H, Hill J, Nestorov I: An exploratory dose-escalating study investigating the safety, tolerability, pharmacokinetics and ... used as a standard to develop a bead-based immunoassay by using antiAPRIL capture mAb and fluorescence-labeled anti-BLyS detection mAb to quantify native heterotrimers in human sera The bead-based...
... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... injury was decreased, however, and there was also a significant increase inthe cardiac index inthe NAC-treated group [20] Conclusions This is an exciting time for intensivists involved inthe care ... phosphodiesterase activity, thereby enhancing the intracellular content of cAMP that exerts both vasodilation and anti-inflammatory effects Pentoxifylline has been reported to inhibit platelet and leukocyte...
... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... virus-containing supernatant were analyzed using the Quan-T-RT assay system (Amersham) The samples were then analyzed using the 1600 TR Liquid Scintillation Analyzer (Packard) To determine the RT activity ... indicated that purifying selection pressure was operating against genomes that had inactivating mutations inthe gag gene The observation that a few of the viral RNA-derived sequences had inactivating...
... remunerations, to being classed as primary healthcare professionals inthe USA and this may encourage chiropractors thereto pursue a primary healthcare title This might explain the apparent difference in ... be easier for a chiropractor to claim a primary healthcare role inthe UK than inthe USA However due tothe differences inthe healthcare systems thereare other benefits, such as remunerations, ... other healthcare professionals and promoting interdisciplinary care including becoming more involved with primary healthcare teams within the NHS List of abbreviations AAFP: The American Academy...
... often has “salt and pepper” look, white “veins”, most grains are harder than a nail Coarse to fine grain, surface is shiny, foliation (wavy or flat layers), softer than a nail Rock has layers* ... e grained”) Layers are wide bands Fine grained matrix Rhyolite (I) Coarse grained Granite (I) Fine grained matrix; black, dk gray Light gray Basalt (I) Andesite (I) Med grained; black, gray, ... shiny surfaces by the conversion of clay minerals to mica; the generation of metamorphic layering called foliation (“wavy” layering); injection of minerals (usually quartz and feldspar) in veins...
... phí - Thereare some books - There aren't any boooks - There aren't any lamps - Thereare two lamps - There aren't any mirrors - There is a mirror - Thereare two chairs near the - Thereare two ... wardrobes in your bedroom? Arethere any sofas in your living room? Arethere any cupboards in your diningroom? Arethere any pictures or maps Yes, thereare Yes, thereare No, there aren't Yes, there ... sổ?) - Thereare four (Có c a sổ.) - How many chairs are there? (Có ghế?) - Thereare four (Có ghế.) - How many pictures are there? (Có tranh?) - Thereare (Có tranh.) - How many beds are there? ...
... for the flocculation of the organic pollutants in wastewater, because the flocculated and filtrated organics need to be further fermented anaerobically and the inorganic flocculants contained in ... organic pollutants by organic flocculants Inorganic flocculants, such as aluminum and ferric salts, are popular at present However, these inorganic flocculants are not suitable to be used inthe ... through A2 O method (anaerobic-anoxic-oxic process) as the conventional one does The inorganic nutrients in wastewater are not even considered as pollutants anymore, instead, they are seen as a kind...
... Just a smile and the rain is gone Can …………… believe it (yeah) There' s an angel ……………… next to me, reaching for my heart Just a …………… and there' s no way back Can hardly believe it (yeah) But there' s ... …………… and pray you'll have a change of hear.t But I can't make you see it …………………… that something only love can In your arms as the dawn is breaking, face to …………… and a thousand miles apart I've ... ……………………… ** Say a little prayer (my sweet love) Dreams will ………… me there Where the skies are ……………… (woah yeah~) to see you once again Over seas from coast to ………………… To find the place I love the most,...
... should feel satisfied at gaining a draw having trailed by a goal and a man against Barcelona He didn't say this but he probably also felt that inferences would once again be drawn about Qatar's methods ... certainty and intensity inthe MenP than in Vietnamese MODAL In Vietnamese, thereare less MAs expressing probability, ADJUNCTS IN ENGLISH AND VIETNAMESE SPORTS certainty and intensity inthe ... Collecting data between the semantics and the pragmatics of modal adjuncts ina b) Setting up smaller corpora for MAs according tothe style particular context c) Classifying MAs d) Describing and...
... learn grammar because "there is no point in learning grammar for the sake of learning grammar Grammar is the support system of communication and we learn it to communicate better Grammar explains ... I.1.3 Grammatical functions Ina clause or phrase, noun always plays an important role because it is the main word determining the meaning of the whole clause or phrase Noun can be prepositional object ... made of rubber and the ball was made in India" (the rubber may not be grown in India) Second, "the ball is made of rubber and the rubber is grown in India" (the ball may not be made in India)...
... II/ Names of International Organizations are used widely in Vietnam as mother tongue 30 ADP: Asia Development Bank AFTA: Free Trade Area APEC: Asia Pacific Economic Cooperation ASEAN: Association ... Practitioners AAPT: American Association of Physics Teachers AASA: American Association of School Administration AASECT: American Association of Sex Educators, Counselors and Therapists ACCA: American College ... ITO: International Trade Organization ITU: International Telecommunication Union LAES: Latin American Economic System LAFTA: Latin American Free Trade Association LAIA: Latin American Integration...