0

a useful tool to investigate the biomechanical behavior of implant supported prosthesis

A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

Môi trường

... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
  • 20
  • 643
  • 0
Báo cáo toán học:

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Toán học

... SR, AS and HH contributed equally to the content of the article and gave their final approval All authors read and approved the final manuscript Competing interests The authors declare that they ... kg−1) A total amount of about 700 kg artificial sediment was prepared for the experiments in the annular flume and half of the sediment was spiked with the abovedescribed PAHs This approach was ... one of the major challenges of this proofof-concept study The characterization of sedimentological parameters resulted in critical bed shear stresses and temporal variations of suspended particulate...
  • 5
  • 435
  • 0
Báo cáo y học:

Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc

Báo cáo khoa học

... position The CA-6000 linkage measures head position relative to the base affixed at the first thoracic vertebra Matching Lucite blocks, one attached to the headband of the CA-6000, and the other attached ... Mathsoft Inc, Cambridge, MA) Variables of primary interest were the average head orientation at the target position for seconds before deconditioning and the average head orientation at the target ... CA) was used to measure head position and motion with respect to the upper thoracic spine in the cardinal planes: sagittal (AP-flexion), frontal (lateral flexion), and horizontal (rotation) The...
  • 7
  • 211
  • 0
báo cáo hóa học:

báo cáo hóa học:" The influence of a weight-bearing platform on the mechanical behavior of two Ilizarov ring fixators: tensioned wires vs. half-pins" pdf

Hóa học - Dầu khí

... and data analysis MC participated in data analysis and helped to draft the mauscript TAS participated in study design and coordination of the study All authors read and approved the final manuscript ... healing [21, 22] The aim of this study was to compare the axial stiffness of a two-ring, half-pin frame with that of the traditional four-ring, all-wire frame Additionally, the biomechanical ... Conclusions: A weight-bearing platform has substantial influence on the biomechanical performance of an Ilizarov external fixator Half-pins induce greater stiffness to the Ilizarov external fixator and allow...
  • 23
  • 856
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
  • 12
  • 616
  • 0
Báo cáo

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo khoa học

... environment [3]. One of the disadvantages is  that  the relative  importance  of evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of ... and  accounts  for  75%  to 85%  of the total  yearly  rainfall,  whereas  the dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.   ... negative  impacts,  especially  in  the future,  when  the province has the plan to develop the aquaculture  to be the key sector of local economics [6].   A re a (h e c ta r s ) January  and ...
  • 13
  • 487
  • 0
báo cáo hóa học:

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

Hóa học - Dầu khí

... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
  • 8
  • 492
  • 0
báo cáo khoa học:

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Báo cáo khoa học

... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup of IDC (Table 2) Further univariate analyses revealed no...
  • 9
  • 423
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx

Báo cáo khoa học

... particular format of the SCT and on the classification of the AJCC (American Joint Committee on Cancer) of the tested cancers Participation was voluntary Demographic data was collected for students and ... non-parametric alternatives were used To evaluate the capacity to significantly discriminate the scores of the three groups, the non-parametric KruskallWallis test was applied The non-parametric ... favour of SCT as a reliable and valid tool to evaluate the clinical reasoning of radiation oncology residents The use of this instrument will allow for a more comprehensive evaluation of a resident's...
  • 6
  • 392
  • 0
Báo cáo y học:

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo khoa học

... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... ‘chemotherapy and radiotherapy’ are indicated in the branch of the ‘fishbone’ that shows the cause of ovarian failure, a potential cause for secondary amenorrhea/oligomenorrhea (Figure 1) The cited ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
  • 3
  • 381
  • 0
Báo cáo y học:

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Báo cáo khoa học

... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
  • 9
  • 506
  • 0
báo cáo khoa học:

báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

Báo cáo khoa học

... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
  • 9
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf

Báo cáo khoa học

... in a treatment questionnaire (see below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence ... between the PSW and the participant will take place on-site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant ... other health appointments, help them to locate information about mental health services and social groups, and help them find ways to ensure good mental health once the program is over A total of...
  • 7
  • 443
  • 0
Building a Survey Tool to Assess Consumers’ Perception and Behavior Towards Green Consumption

Building a Survey Tool to Assess Consumers’ Perception and Behavior Towards Green Consumption

Thạc sĩ - Cao học

... Sometimes, = Often, = Always) The Frequency Scale is used to measure the actual behavior, while the Agreement Scale is used to measure the factors that affect behavior In addition, the responses of consumers ... environment bags/recycling bags, to use clean plastic bags many times • The green waste treatment: to throw garbage in the right place, to classify inorganic and organic garbage - The promoting behaviors ... perception and self- awareness about the resources, barriers or facilitators to help them conduct green consumption behavior, such as their own availability of time, of money, of access to information,...
  • 9
  • 249
  • 0
A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV)   induced reactive oxygen species (ROS) production in u937 cells

A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells

Tổng hợp

... II (Ang II) results in the activation of AT1 receptor (AT1R) and its translocation to the caveolin-1 containing lipid raft domains (Cai et al., 2003; Park et al., 2006) The activation of AT1 ... necrosis and autophagic cell death Apoptosis is referred to as a form of programmed cell death The ‘hallmarks’ or morphological characteristics associated with apoptosis are plasma membrane blebbing, ... 2007) Another major role of NOX enzymes would be in regulating the levels of pro-inflammatory and anti-inflammatory cytokines (Kawahara et al., 2007) ROS generated via NOX serve as secondary signaling...
  • 110
  • 528
  • 0
Building a Survey Tool to Assess Consumers’ Perception and Behavior Towards Green Consumption

Building a Survey Tool to Assess Consumers’ Perception and Behavior Towards Green Consumption

Tài liệu khác

... Sometimes, = Often, = Always) The Frequency Scale is used to measure the actual behavior, while the Agreement Scale is used to measure the factors that affect behavior In addition, the responses of consumers ... Sometimes, = Often, = Always) The Frequency Scale is used to measure the actual behavior, while the Agreement Scale is used to measure the factors that affect behavior In addition, the responses of consumers ... environment bags/recycling bags, to use clean plastic bags many times • The green waste treatment: to throw garbage in the right place, to classify inorganic and organic garbage - The promoting behaviors...
  • 18
  • 264
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Y học thưởng thức

... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... farm level Such veterinarians are motivated to collect valid data at the herd level They perceive the collection of the data in and of itself as the basis for taking relevant action at the farm ... that specific situation?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a qualitative method to use empiric data (e.g., interview) to describe the variation...
  • 10
  • 587
  • 0
Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Thạc sĩ - Cao học

... that they want to be identified as a member of the family Hence, the children tend to take on many behavioral characteristics of the parents and their behaviors are modified by that of the parents ... repeat and participate in a single activity The advantages of using VCDs in English class are also clearly understood as shown in the table and chart above One of the most appreciated materials applied ... based on the assumptions that the main determinants of motivation are the learners' attitudes to the target language community and their need to learn the L2 Motivation can affect the extent to...
  • 45
  • 516
  • 0
Indoor tests to investigate the effect of brine depth on the performance of solar still

Indoor tests to investigate the effect of brine depth on the performance of solar still

Môi trường

... series to supply a total current of 4.5 A, a voltage of 220 V and a total power flux of approximately 1000 W/m² to simulate the solar radiation intensity A variac was used to regulate the input ... tests) These values are the initial value of the production line in the figures This may be due to the large thermal capacity of water, which is directly related to water mass, causing a continuous ... solar radiation by suitable variable heating system The indoor tests allow a greater control on the input power and eliminate many factors that may affect the accuracy of the experimental results...
  • 8
  • 534
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25