... CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC ... plated and cultivated at 28°C on LB medium containing kanamycin and gentamycin, and used for agroinoculation as described below Plant inoculation Tomato plants cv Nainemor were inoculated at ... the data obtained with the IR mutant indicate that increased accumulation of the virus at the early stage of infection may be damaging for the plant, even if final accumulation levels are unchanged...
... point is proved as in Theorem 2.7 Remark 3.3 A parallel result in the nonincreasing case cannot be obtained using a similar argument as in Theorem 2.3 because the proof that (xn) is a Cauchy sequence ... which are fixed points of T and z ≠ y We consider two cases Case 1: Suppose that z and y are comparable Without loss of generality, we suppose z
... feedmills in Vietnam • Planning and conducting training activities associated with the analysis of the survey data, including planning for appropriate training in Australia for two members of the CAP ... at IPSARD on survey and data collection techniques; and market analysis, including value chain analysis, production economics, and industrial organisation • On-the-job training for IPSARD staff ... skills in data cleaning using STATA In October, Dr Brennan and Ms Marsh designed templates for the CAP team to provide guidance and direction for the preliminary analysis of the data Dr Brennan and...
... build institutional capacity in linking problem formulation and data collection, and the results of quantitative analysis to policy advice Provide a training course at IPSARD in survey and data collection ... organisation, and production economics • Training workshops at IPSARD on survey and data collection techniques; and market analysis, including value chain analysis, production economics, and industrial ... the CARD PMU, and hence there was a delay in signing the Contract between UWA and Hassall & Assoc This resulted ina delay in establishing the budget line at UWA (obtained on 31.07.07), anda corresponding...
... company • The importance of storage capacity and its impact on buying and importing strategies Can the GoV play a role in providing storage capacity for SMEs? • Varying quality control capability ... concentrated at large agents, and not much to smaller agents operating in remote areas This avoids payment risk with farmers as the agents pay the company directly • Large companies say that small companies ... growing at 8-9% per year globally, and the growth in the domestic animal feed sector is 15% per year Vietnam needs to import a lot of the raw material inputs for animal feed andin 2006 40% of raw...
... potentially have valuable input into policy for that sector The Thai Feed Mill Association was also mentioned as an enterprise association that had policy input in Thailand A further idea was that ... and storage of raw material inputs, and lack of capacity to implement quality control Policy approaches needed to address constraints are addressed ina separate Policy Brief: “Constraints Facing ... (and MARD) on agriculture markets and demand/supply issues was in line with IPSARD’s focus The opinion was expressed that IPSARD has access to more policy-relevant information and more input into...
... and data collection techniques; and market analysis, including value chain analysis, production economics, and industrial organisation • Training on data management techniques including: data entry ... Build capacity at IPSARD agricultural marketing research, specifically in analysis of the value chain, industrial organisation, and production economics • Training workshops at IPSARD on survey and ... reporting period, the hands-on training at CAP in Hanoi provided by Dr Brennan and Ms Marsh focussed on data cleaning, data analysis and report writing In August 2009, two CAP staff (Pham Thi...
... potentially have valuable input into policy for that sector The Thai Feed Mill Association was also mentioned as an enterprise association that had policy input in Thailand A further idea was that ... and storage of raw material inputs, and lack of capacity to implement quality control Policy approaches needed to address constraints are addressed ina separate Policy Brief: “Constraints Facing ... (and MARD) on agriculture markets and demand/supply issues was in line with IPSARD’s focus The opinion was expressed that IPSARD has access to more policy-relevant information and more input into...
... small- and medium-scale companies 13 • Thailand, Malaysia and Indonesia have adopted the Japanese SME model with variations to suit each nation's cultural and social environment In Thailand for ... training Members can “exchange information and discuss difficulties” They also say they are a one stop shop for Government – we have all the information” – and appear to act as a lobby group for ... self-sufficient in corn and cassava for livestock feed, only importing protein products such as soybean meal, soybean, some fishmeal and bone meal SMEs can have an advantage in proximity to raw materials...
... small- and medium-scale companies 13 • Thailand, Malaysia and Indonesia have adopted the Japanese SME model with variations to suit each nation's cultural and social environment In Thailand for ... training Members can “exchange information and discuss difficulties” They also say they are a one stop shop for Government – we have all the information” – and appear to act as a lobby group for ... self-sufficient in corn and cassava for livestock feed, only importing protein products such as soybean meal, soybean, some fishmeal and bone meal SMEs can have an advantage in proximity to raw materials...
... a database table (an observation) A column ina database table (a variable) Tables contain the data in the database Queries are used to perform calculations on tables in the database, to create ... Microsoft Access • Data cleaning and analysis – techniques using Stata This chapter contains tips and techniques for data cleaning, building data output templates, and data analysis Training notes ... lot of blank data, the database will only add as many records as is required • Database designs make it easy to aggregate data into a form that can be used by statistical software A glossary of...
... “Perturbed Ishikawa iterative algorithm and stability for nonlinear mixed quasi-variational inclusions involving A, η -accretive mappings,” Advances in Nonlinear Variational Inequalities, vol 11, ... and M : X → 2X be an A, η -accretive set-valued mapping If A, η Ik A − ARρ,M A − ρFA , andfor all x1 , x2 ∈ X, ρ > and qγ > A, η A, η − A Rρ,M A x2 − ρF A x2 A x1 − A x2 , Jq A Rρ,M A x1 − ρF A ... 3.28 as follows: A zn − A x∗ q ≤ A, η − an A xn an A Rρn ,M sn an A Rρn ,M s∗ A, η − an A xn − A x∗ ≤ q A, η − − an A x∗ A, η − A Rρn ,M s∗ an A Rρn ,M sn ≤ cq − an A xn − A x∗ A, η q A, η A xn − A x∗...
... 3.1.3 Quality control The fact that advanced international standards for quality control such as ISO and HACCP are only applied by foreign-owned and joint venture companies, indicates better quality ... regions: Ha Noi, Ha Tay and Hung Yen provinces located in the Red River Delta; Binh Duong and Dong Nai in the South East; and Tien Giang and Long An in the Mekong River Delta The mills have been categorized ... mix and prices similar to large mills They have a sales strategy that targets a different customer base to large mills (i.e retail agents rather than wholesale agents) Small-sized mills (producing...
... differentiable expanding operator A 14 A fixed point theorem The main theorem on differentiable expanding operators We now formulate and prove the following new inverse mapping theorem for nonlinear ... inverse mapping fora given nonlinear expanding mapping of X into itself involves a specific fixed point theorem As a corollary of our main Theorem 5.1, we obtain the following fixed point theorem for ... then A is a stable continuous operator and R (A) = X The function g(·) is a stabilizing function of A Proof Using the stability of the mapping As and the triangle inequality, we obtain As x1 − As...
... it may have at most a fixed pointin U Good accounts on all the results summarized above can be found in [2, Section 2.3] and [4, Sections 4.4–5.3] In the sequel, ϕ will always denote an analytic ... (2.9) then ϕ has a fixed pointin U Conversely, if ϕ is an analytic self-map of U other than the identity and ϕ has a fixed point, then there exist finitely many points z1 , ,zk in U such that condition ... situated in the same connected component of C \ A( z,ϕ(z), (1 − |ϕ(z)|2 )/(1 − |z|2 )) as z By straightforward computations, one can obtain the following formulas for the endpoints eiθ1 and eiθ2...
... Development Bank AIC Advanced International Joint Stock Company APEC Asia – Pacific Economic Cooperation ASEAN Association of Southeast Asian Nations ATM Automatic Teller Machine B2B Business to Business ... frequently has to utilize expanding the total market and market share defense strategies Meanwhile, the market-challenger is always involved in attack strategies such as frontal attack, flank attack, ... stakeholder and risk management cannot absolutely be missed in preparing for doing international business 2.6 Foreign market entry So far, all essential information for making a decision on market...
... Uniformly lipschitzian families of transformations in Banach spaces, Canad J Math 26 (1974) 1245–1256 W A Kirk, A fixed point theorem for mappings which not increase distances, Amer Math Monthly 72 ... set and T (K) ⊂ K} A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces 151 Clearly F is a nonempty family, since C ∈ F By weakly compactnees of C and Zorn’s Lemma, F has a ... (2) andA Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces 153 (For details, see [5]) In the sequel all topological notions (boundedness, compactness, weak compactness, ) in...
... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce inflammatory ... which may induce inflammation again, damage the lung, and finally result in fatal pneumonia and acute respiratory tract infection syndromes This indicates that influenza patients require both antiviral ... Ichinohe T, Ito S, Takahashi H, Sawa H, Chiba J, Kurata T, Sata T, Hasegawa H: Protection against influenza virus infection by intranasal administration of C3d-fused hemagglutinin Vaccine 2003, 21:4532-4538...
... during these five years Dr Mojtaba Ranjbar, Dr Mohammadreza Keshtkaran, Mr Hassan Amini, Mr Mehdi Ranjbar, Dr Hossein Eslami, Mr Sai Sathyanarayan, for making our home warm and joyful andfor ... Hosseini Farahabadi, Mr Sasan Safaie, Mr Hooman Shams Borhan, Mr Amir Mortazavi, Dr Abbas Eslami Kiasari They always supported me in any circumstances I would also like to thank all my flat mates ... these information and features can be easily applied using flat naming system Notice that the names should be unique in their domain, requesting area If the domain of a name is as small as a campus,...
... utilizing MACS In my evaluation of the sampling methods, I am taking into account the requirements of both human and animal studies and will make comparisons against MACS samples where appropriate ... use in prenatal diagnosis (Pongsritasana, Wongratanacheewin et al 2006) By first enriching for fetal cells using MACS against fetal specific antibodies (Zhao, Ozaki et al 2002) (Ganshirt-Ahlert, ... et al 2004; Capodieci, Donovan et al 2005) A study by Wong et al and Saito-Hisaminato et al mapped the transcription profiles of several human Page organs including liver, lung, brain and placenta...