a the correlation between the r2 and the distance between copy number polymorphism cnp and single nucleotide polymorphism snp
Statistical methods for the detection and analyses of structural variants in the human genome
... main reasons: the raw data are readily available and there are several studies which have characterized the CNV profiles for these individuals and often used as the „gold standard‟ (Kidd et al., ... of years are high density SNP arrays and array comparative genomic hybridization (aCGH) arrays; the former (SNP arrays) are also commonly used for detection of ROHs However, the data generated ... be aligned (Ye et al., 2009) 22 The idea is that where the location of the unmapped read may span the breakpoint of the CNV SR analysis has the advantage of being able to pinpoint the location...
- 171
- 567
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... width at half height) of the heat absorption curve All values of thermodynamic parameters were calculated for mol base pairs, taking an average molecular mass of a DNA base pair as 660 Da Results ... investigation of actinomine–DNA complexes has shown [28] that intercalation and external binding of ligand with DNA, characterized by the parameter r (the number of mol of ligand per mol of base pairs), ... transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well as DHbind and DSbind...
- 8
- 331
- 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc
... for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA ... (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’) ... (5’CCAGCTTGTTCCCTGATAACTTCTTCCCCACC-3’) and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT GG-3’);...
- 15
- 477
- 0
báo cáo khoa học: " A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst" potx
... FI: participated in the surgical treatment and in the follow-up of this patient, MT: drafted the manuscript and reviewed the literature, FMA: participated in the surgical treatment and in the ... trauma usually precedes its onset Synovial-like metaplasia associated with prostheses and breast implant capsules has also been reported and may occur in postsurgical cutaneous scars, which are ... General Hospital, Bari, Italy, 3Department of "Head and Neck Diseases", Hospital "Fatebenefratelli", Rome, Italy, 4Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy, 5Department...
- 3
- 292
- 0
Báo cáo y học: "Association between copy number variation of complement component C4 and Graves’ disease" ppsx
... designed the study, managed the literature searches, undertook the statistical analysis, and wrote the draft of the manuscript LW designed and performed the experiments CTC and WCC recruited and maintained ... maintained the clinical information of participants LWLL and TYT undertook the statistical analysis CHT and FJT directed the study and reviewed the results All authors contributed to and have approved ... Statistical analysis Statistical analysis was performed using the statistical package PASW for Windows (version 18.0; SPSS Inc.) The demographics of patients and healthy individuals were analyzed...
- 8
- 350
- 0
báo cáo khoa học: " Ethical issues raised by common copy number variants and single nucleotide polymorphisms of certain and uncertain significance in general medical practice" potx
... behaviors are acceptable and appro riate The primary approach used to avoid the p birth of affected children has been prenatal diagnosis and termination of affected pregnancies, although other ... and testing for single gene disorders and carrier testing, there is no evidence that ancestry testing by SNPs has greater medical value than the information available from history and physical ... coincidental Alternatively, even if a normal parent has the CNV, there could be incomplete penetrance, and the CNV may be the cause of the phenotype in the child What should the laboratory report to the...
- 6
- 307
- 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications ... of forms and meanings of their native language and culture to the foreign language and culture- both productively and when attempting to speak the language and to act in the culture and receptively ... between the studied objects in terms of MiCA and MaCA basing on the theoretical background As far as MiCA was concerned, these two verbs are analyzed and contrasted in respects of grammatical features,...
- 52
- 1,860
- 25
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... residues and solvent molecules engaged in ligand recognition and stabilization are drawn as balls -and- sticks and spheres, respectively The major interactions established between the DHAP inhibitor and ... profile and the associated variation in QA and PA levels [7], and other investigations have clearly demonstrated that changes in ACMSD activity are readily reflected by serum and tissue QA levels ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... 4003–4012 Hamada FN, Koshiyama A, Namekawa SH, Ishii S, Iwabata K, Sugawara H, Nara TY, Sakaguchi K & Sawado T (2007) Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologue, ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... Schematic diagram of the truncation mutants of CcCac1L (C) Interaction between CcCac1L and CcLim15 in a yeast two-hybrid assay The inserts in the activation domain (AD) and DNA-binding domain...
- 10
- 487
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... hierarchy for concept generalization Atomic f o r m u l a i n FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE The case grammar, as a basis of internal representation, ... the special combination of concepts like WAR with DISASTAR They play a role to match syntagmatic relation with semantics in terms of syntax These two processes analize the pragmatic, modal, and ... binary relation The semantics in the sense used here may not necessarily be shared among languages, while facts are shared among languages Legato built on the model is syntactic and semantic analysis...
- 7
- 373
- 0
Báo cáo khoa học: Correlation between conformational stability of the ternary enzyme–substrate complex and domain closure of 3-phosphoglycerate kinase potx
... temperature T, and IN and IU are the intercepts and mN and mU are the slopes of the pre- and post-transitional base lines of the raw data, respectively Quantitative analysis of the experimental data ... the slope and the intercept on the ordinate give DHà and DSà, respectively The calorimetric data were also analysed according to another type of transformation of the data, as described by Sanchez-Ruiz ... Sigma (St Louis, MO, USA) as a preci- 1880 A Varga et al pitate in the presence of m ammonium sulphate Their activity was determined using 3-PG and MgATP as substrates in a coupled assay using GAPDH...
- 19
- 460
- 0
HOW TO BRIDGE THE DISTANCE BETWEEN BUSINESS STRATEGY AND DESIGN.A VISUAL PRESENTATION BY MARTY potx
... brand-building READY? LET’S START BY DISPELLING SOME MYTHS FIRST A brand is not a logo SECOND A brand is not an identity X FINALLY A brand is not a product So what exactly is a brand? A BRAND ... INTUITIVE EMOTIONAL SPATIAL VISUAL PHYSICAL DOES THE LEFT BRAIN KNOW WHAT THE RIGHT BRAIN IS DOING? When both sides work together, you can build a charismatic brand A CHARISMATIC BRAND is any product, ... most companies, STRATEGY is separated from CREATIVITY by a wide gap On one side of the gap are STRATEGIC THINKERS ANALYTICAL LOGICAL LINEAR NUMERICAL VERBAL On the other side are CREATIVE THINKERS...
- 162
- 460
- 0
![Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt](https://media.store123doc.com/images/document/14/rc/tl/small_tlm1396203606.jpg)
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt
... GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG TTTG-3¢ (lower case type indicates the introduced mutations, new cleavage sites ... (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23] cleaved with the same enzymes creating the ... 16 Kaneko, T., Sato, S., Kotani, H., Tanaka, A. , Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A. , Muraki, A. , Nakazaki,...
- 10
- 447
- 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot
... follow the appearance of the typical absorption spectrum of the CO-ferrous CYP1 1A1 complexed form, characterized by absorbance decreases at 390, 430 and 480 nm and by the appearance of a peak at ... FNR and lM Adx were initially mixed in the cell measuring compartment and lM CYP1 1A1 was placed in the second compartment After the samples were made anaerobic, an excess of NADPH was added to the ... Kinetic parameters for the anaerobic reaction between FNRrd and Adxox Data calculated from steady-state spectra recorded in Fig 2A at 414 nm Adx concentration dependence of (A) kobs1, kobs2 and V0...
- 10
- 400
- 0
báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx
... In each trial, ECG and finger photo-plethysmogram signals were measured and recorded with a handmade Mayer-wave analyzer [16] The resolution of A/ D converter and the sampling rate are 12 bit and ... population and medical cost inflation In Japan in 2006, a new law regarding the national health was passed and it fixes a months limit to the coverage for rehabilitation programs For this reason, ... decreased while watching the video and there was significant difference between the two groups both at Part-2 and Part-3 (t-test, p < 0.05) In addition, between Day1 and Day3, there was a delay...
- 6
- 534
- 0
Báo cáo hóa học: " The correlation between radiative surface defect states and high color rendering index from ZnO nanotubes" docx
... be assigned to the entrance of the electron beam into the nanotube where it can travel adopting a helical path by striking again and again with the inner surface of the nanotube Secondly, the ... compared to nanorods These originated surface defect states can act as additional radiative recombination centers and it is also a wellknown fact that the presence of surface defect states is always ... results from transmission electron microscope All the authors participated in the revision and approval of the manuscript Page of 11 Israr MQ, Sadaf JR, Yang LL, Nur O, Willander M, Palisaitis J, Persson...
- 5
- 285
- 0
Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx
... (in the region that has three copies in Dp/+ flies and one in Df/+ flies) female soma and gonads; that is, the expression ratios between X chromosomes and autosomes of XX;AA female soma and X;AA ... (X;AA) but also XX;AA ovaries and X;AA sex-transformed ovaries all centered on (Figure 1) Having validated their approach, Gupta et al [8] compared expression of the X chromosome with that of the ... male soma and germline, C elegans male soma, and mammalian male soma is upregulated (dark blue, up-arrow) In Drosophila female soma, the X chromosomes are both expressed and thus not upregulated...
- 3
- 315
- 0
Báo cáo y học: " A rigid barrier between the heart and sternum protects the heart and lungs against rupture during negative pressure wound therapy" doc
... NPWT The macroscopic appearance of the heart and lungs was inspected and the area of epicardial petechial bleeding was measured after 12 and 24 hours of NPWT Material and methods Animals A porcine ... regard to injury after 12 and 24 hours The length and width of the area affected by petechial bleeding on the epicardial surface were measured and the area was calculated (Figure 1) Calculations ... Foundation, the Anna-Lisa and Sven-Erik Nilsson Foundation, the Jeansson Foundation, the Swedish HeartLung Foundation, Anna and Edvin Berger’s Foundation, the Märta Lundqvist Foundation, and Lars...
- 5
- 321
- 0
Báo cáo y học: "a diagnostic dilemma between psychosis and post-traumatic stress disorder: a case report and review of the literature" ppsx
... images of the traumatic event, with a markedly diminished interest and participation in significant activities and the avoidance of thoughts and conversations associated with the trauma She also ... literature and drafted the manuscript PP carried out the follow up on the patient, took part in the scientific discussion and helped to draft the manuscript All authors read and approved the final manuscript ... reactive She described vivid and clear auditory and visual hallucinations and persecutory delusions Her medical psychiatric, personal, and family histories were unremarkable A physical examination,...
- 5
- 407
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25