Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and Satoshi H. Namekawa Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, Japan Keywords chromatin assembly; chromatin assembly factor 1 (CAF-1); Lim15/Dmc1; meiotic recombination; proliferating cell nuclear antigen (PCNA) Correspondence K. Sakaguchi, Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda-shi, Chiba-ken 278-8510, Japan Fax: +81 4 7123 9767 Tel: +81 4 7124 1501 (ext. 3409) E-mail: kengo@rs.noda.tus.ac.jp Website: http://www.tus.ac.jp/en/grad/ riko_app_bio.html S. H. Namekawa, Department of Molecular Biology, Massachusetts General Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02114, USA Fax: +1 617 726 6893 Tel: +1 617 726 5966 E-mail: namekawa@molbio.mgh.harvard.edu Present address †Quantum Beam Science Directorate, Japan Atomic Energy Agency, Gunma, Japan *These authors contributed equally to this work (Received 7 January 2008, revised 24 February 2008, accepted 25 February 2008) doi:10.1111/j.1742-4658.2008.06357.x In eukaryotes, meiosis leads to genetically variable gametes through recom- bination between homologous chromosomes of maternal and paternal ori- gin. Chromatin organization following meiotic recombination is critical to ensure the correct segregation of homologous chromosomes into gametes. However, the mechanism of chromatin organization after meiotic recombi- nation is unknown. In this study we report that the meiosis-specific recombinase Lim15/Dmc1 interacts with the homologue of the largest subunit of chromatin assembly factor 1 (CAF-1) in the basidiomycete Coprinopsis cinerea (Coprinus cinereus). Using C. cinerea LIM15/DMC1 (CcLIM15) as the bait in a yeast two-hybrid screen, we have isolated the C. cinerea homologue of Cac1, the largest subunit of CAF-1 in Saccharo- myces cerevisiae, and named it C. cinerea Cac1-like (CcCac1L). Two-hybrid assays confirmed that CcCac1L binds CcLim15 in vivo. b-Galactosidase assays revealed that the N-terminus of CcCac1L preferentially interacts with CcLim15. Co-immunoprecipitation experiments showed that these proteins also interact in the crude extract of meiotic cells. Furthermore, we demonstrate that, during meiosis, CcCac1L interacts with proliferating cell nuclear antigen (PCNA), a component of the DNA synthesis machinery recently reported as an interacting partner of Lim15/Dmc1. Taken together, these results suggest a novel role of the CAF-1–PCNA complex in meiotic events. We propose that the CAF-1–PCNA complex modulates chromatin assembly following meiotic recombination. Abbreviations ATCC, American Type Culture Collection; Cac1, chromatin assembly complex 1; CAF-1, chromatin assembly factor 1; CcCac1L, Coprinopsis cinerea Cac1-like; CPRG, chlorophenol red-b- D-galactopyranoside; DSB, double-strand break; IPTG, isopropyl thio-b-D-galactoside; PCNA, proliferating cell nuclear antigen; RLM-RACE, RNA ligase-mediated-RACE; RU, resonance unit; SPR, surface plasmon resonance. 2032 FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS In eukaryotes, sexual reproduction is achieved by the conjugation of genetically variable gametes, which are generated during meiosis in the parental germline. Mei- osis consists of two rounds of chromosome segrega- tion, resulting in gametes with half the number of chromosomes in order to prepare for conjugation. During prophase of the first meiotic division, recombi- nation takes place between homologous chromosomes of maternal and paternal origin. This is followed by the segregation of maternal and paternal copies of each chromosome. A physical connection at the site of homologous recombination, called the chiasma, orients homologous chromosome pairs towards opposite spin- dle poles at meiosis I [1]. Therefore, chromatin organi- zation following meiotic recombination is required to establish the chiasma and to segregate homologous chromosomes. Meiotic recombination comprises several steps beginning with meiosis-specific double-strand breaks (DSBs). A single-strand overhang is formed by exonu- clease activity and invades the homologous double- stranded region of the other allele. These steps of homology search and recombination are catalysed by two bacterial RecA homologues, Rad51 and Lim15/Dmc1. Rad51 catalyses both somatic and meiotic recombination, whereas Lim15/Dmc1 is meio- sis-specific [2–5]. Rad51 and Lim15/Dmc1 are compo- nents of a multiprotein complex at the site of recombination [6,7]. In order to understand the mecha- nisms of meiotic recombination, much effort has been made to identify additional components of the Rad51 and Lim15/Dmc1 complex, in particular Lim15/Dmc1 interacting partners. Recent analysis has identified various interacting partners of Lim15/Dmc1, which seem to be involved in homology search and strand exchange. Tid1/Rdh54, an SWI2/SNF2 family of chromatin-remodelling factors, promotes the co-localization of Rad51 and Lim15/Dmc1 [8]. The heterodimeric complex of Hop2 and Mnd1 stimulates strand exchange of Lim15/Dmc1 [9–11]. The meiosis-specific proteins Mei5 and Sae3 form a complex with Lim15/Dmc1 and are necessary for the assembly of Lim15/Dmc1 [12,13]. Furthermore, the DNA mismatch repair protein MSH4 (MutS homologue 4) [14], the tumor suppressor protein p53 [15], DNA topoisomerase II [16], the sumoylation pro- tein Ubc9 [17] and the DNA synthesis-related factor proliferating cell nuclear antigen (PCNA) [18] have been reported to interact with Lim15/Dmc1. These proteins seem to participate in the modulation of Lim15/Dmc1. However, how chromatin is organized following meiotic recombination has not been described. In order to explore chromatin organization after meiotic recombination, we designed experiments to investigate the possible interactions between recombi- nation proteins and chromatin assembly factors. In this article, we report that the largest subunit homo- logue of chromatin assembly factor 1 (CAF-1) is a novel interacting partner of Lim15/Dmc1. CAF-1 con- sists of three subunits that are highly conserved amongst yeast, plant, fly and human [19–23]. CAF-1 deposits histones H3 and H4 onto newly synthesized DNA after replication and repair [24–26]. In addition, the largest subunit of CAF-1 interacts with PCNA during replication [27], in nucleotide excision repair [28] and in DSB repair [29,30]. Despite much accumu- lating evidence regarding the role of CAF-1 in chroma- tin assembly following various DNA synthesis events, its involvement in chromatin assembly following mei- otic recombination is unknown. In this study, we test the involvement of CAF-1 in meiotic events. We pro- pose a novel role of the CAF-1–PCNA complex in chromatin assembly following meiotic recombination. Results Isolation of Coprinopsis cinerea Cac1-like (CcCac1L) by two-hybrid screening using CcLim15 as bait To isolate proteins that interact with CcLim15, we per- formed a yeast two-hybrid screen using CcLim15 as bait. A clone was isolated which had moderate amino acid similarity with the largest subunit of human CAF-1 (p150) [19] and the largest subunit of Saccharo- myces cerevisiae CAF-1 (Cac1, chromatin assembly complex 1) [20]. The sequence similarities of this clone with human and S. cerevisiae homologues were found to be 26% and 23%, respectively. Hence, this clone was identified as C. cinerea Cac1-like (CcCac1L). CcCac1L encodes a predicted product of 812 amino acid residues with a molecular mass of 120 kDa. The highly charged KER (lysine/glutamate/arginine-rich; 242–360 amino acids) and ED (glutamate/aspartate- rich; 522–578 amino acids) domains in CcCac1L are conserved amongst human and S. cerevisiae homo- logues (Fig. 1A). The KER and ED domains are known to interact directly with newly synthesized H3/ H4 histones [19,21]. CcCac1L interacts with CcLim15 To confirm the specificity of interaction between CcCac1L and CcLim15, we performed yeast two- hybrid and b-galactosidase assays (Fig. 1C,D). Next, S. Ishii et al. Link between Lim15/Dmc1 and the CAF-1–PCNA complex FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS 2033 we sought to determine which region of CcCac1L was responsible for binding to CcLim15. The N-ter- minus (CcCac1L-N; amino acids 1–381) contained the KER domain, whereas the C-terminus (CcCac1L- C; amino acids 382–812) contained the ED domain (Fig. 1B). Two-hybrid assays demonstrated that CcLim15 interacts with either of the truncated mutants of CcCac1L in the mild selection medium [SD3: lacking histidine, leucine and tryptophan (–His/–Leu/–Trp)], and that CcLim15 preferentially interacts with CcCac1L-N in the stringent selection medium [SD4: lacking adenine, histidine, leucine and tryptophan (–Ade/–His/–Leu/–Trp)] (Fig. 1C). The interaction between the truncated mutants of CcCac1L and CcLim15 was confirmed by b-galactosi- dase assays, which demonstrated a higher binding affinity of CcCac1L-N than CcCac1L-C to CcLim15 (Fig. 1D). Characterization of CcCac1L during meiosis The data above strongly suggest a novel function of CAF-1 as a binding partner of Lim15/Dmc1. How- ever, currently there are no observations available describing the meiotic role of CAF-1. Therefore, we sought to examine the distribution of CcCac1L dur- ing meiosis. First, in order to determine the gene expression profile of CcCac1L during meiotic develop- ment, we performed northern analyses at each stage during meiotic development. Total RNA was extracted from basidia in synchronous culture at 1 h intervals after the induction of meiosis. CcCac1L was expressed at the premeiotic S phase, at the time of genomic DNA replication (Fig. 2A). Homologous chromosomes start to align at the leptotene/zygotene stage. Then, fully synapsed homologues are observed at the pachytene stage. CcCac1L began to accumulate at the leptotene and zygotene stage, and decreased after the pachytene stage (Fig. 2A). This expression profile suggests the specific induction of CcCac1L transcription during the meiotic prophase. Interest- ingly, CcLIM15 showed specific expression during the meiotic prophase [16,31], suggesting that CcCac1L and CcLIM15 are expressed robustly at the same stage. Next, we examined the distribution of CcCac1L and CcLim15 in the meiotic nuclei by immunostaining. We raised a specific antibody against CcCac1L using a purified fragment of CcCac1L, and confirmed its speci- ficity in crude extracts of meiotic cells by western anal- ysis (Fig. 2B). CcCac1L protein localized to nuclei from the premeiotic S phase until the pachytene stage, and then disappeared at metaphase I (Fig. 2C). Consistent with our previous observations [16,17], CcLim15 localized within nuclei from the leptotene/ zygotene stage to the pachytene stage, and disappeared at metaphase I (Fig. 2C). Importantly, significant amounts of CcCac1L and CcLim15 were localized within the nuclei from the leptotene/zygotene stage to the pachytene stage. To examine the interaction between CcCac1L and CcLim15 during meiosis, we performed co-immuno- precipitation analysis using cell extracts from the meiotic prophase in C. cinerea. CcLim15 was co-immunoprecipitated by anti-CcCac1L IgG, but not by control rabbit IgG (Fig. 2D). The reciprocal A B C D Fig. 1. Molecular cloning of CcCac1L and its interaction with CcLim15. (A) Schematic diagram of the CAF-1 large subunits in human, C. cine- rea and S. cerevisiae. The KER and ED domains are represented by black and grey boxes, respectively. (B) Schematic diagram of the trunca- tion mutants of CcCac1L. (C) Interaction between CcCac1L and CcLim15 in a yeast two-hybrid assay. The inserts in the activation domain (AD) and DNA-binding domain (BK) are shown. +, binding; ), no binding. The mild selection medium (SD3: –His/–Leu/–Trp) and the stringent selection medium (SD4: –Ade/–His/–Leu/–Trp) were tested. (D) Interaction between CcCac1L and CcLim15 in yeast using quantitative b-galactosidase assays. b-Galactosidase assays with the other vector pairs in (C) showed little activity below the detection limit of absorbance, and were not quantified. Link between Lim15/Dmc1 and the CAF-1–PCNA complex S. Ishii et al. 2034 FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS experiment confirmed the specific interaction of CcCac1L and CcLim15 in the crude extracts of mei- otic tissues (Fig. 2E). Taken together, these results suggest that the interaction between CcLim15 and CcCac1L is related to specific events during the mei- otic prophase. Interaction between CcCac1L and CcPCNA during meiosis CAF-1 forms a complex with PCNA to deposit histones at the site of newly synthesized DNA during replication and repair. The results above raised the novel possibility that CAF-1 is involved in chromatin assembly following recombination-associated DNA synthesis during meiosis. If so, CAF-1 must form a complex with PCNA in the meiotic prophase. PCNA is expressed abundantly in meiotic prophase I [32]. Interestingly, recent analysis has revealed that PCNA interacts with Lim15/Dmc1 at the time of meiotic recombination [18]. To determine whether CcCac1L interacts with CcPCNA during meiosis, we performed co-immunoprecipitation analysis using cell extracts from the meiotic prophase in C. cinerea. CcPCNA was specifically co-immunoprecipitated by anti-CcCac1L IgG, but not by control rabbit IgG (Fig. 3A). The A C B D E Fig. 2. Interaction between CcCac1L and CcLim15 during meiosis. (A) Northern analysis of CcCac1L expression at various stages during meiosis. Each lane contained 20 lg of total RNA isolated from meiotic cells of C. cinerea at the premeiotic S phase and at every hour after karyogamy (the initiation of meiosis) to 9 h after karyogamy. The blot was hybridized with either CcCac1L (top panel) or C. cinerea glyceral- dehyde 3-phosphate dehydrogenase (CcG3PDH; bottom panel). (B) Western analysis of the rat anti-CcCac1L IgG. The cell extract at the mei- otic prophase was examined. (C) Nuclear localization of CcLim15 and CcCac1L in the nuclei of C. cinerea meiotic cells. Meiotic nuclei were stained with anti-CcCac1L IgG (red) and anti-CcLim15 IgG (green). The nuclei were then counterstained with 4¢,6-diamidino-2-phenylindole di- hydrochloride n-hydrate (DAPI). The meiotic stages are indicated on the left. (D, E) Immunoprecipitation of CcCac1L and CcLim15 from the cell extract at the meiotic prophase; 20 mg of cell extract was incubated with anti-CcLim15 IgG, anti-CcCac1L IgG or control rabbit serum- conjugated beads. After washing the beads, the bound proteins were eluted and analysed by western analysis using anti-CcLim15 IgG (D) or anti-CcCac1L IgG (E). Lane 1, 100 lg of crude extract was loaded. S. Ishii et al. Link between Lim15/Dmc1 and the CAF-1–PCNA complex FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS 2035 reciprocal experiment confirmed the specific interaction of CcCac1L and CcPCNA in the crude extracts of meiotic tissues (Fig. 3B). Next, we sought to examine the binding affinity of CcCac1L to CcPCNA by performing BIAcore analysis with the truncated mutants of CcCac1L, as shown in Fig. 1B. The BIAcore system enabled us to detect the surface plasmon resonance (SPR), which measures the interaction between a ligand on a detection surface (sensor chip) and a ligand that is injected. First, we conjugated CcPCNA to a sensor chip onto which either CcCac1L-N or CcCac1L-C was injected. Consis- tent with results from other organisms [27,33], CcCac1L-N specifically bound to CcPCNA (Fig. 3C), confirming the evolutionarily conserved CAF-1–PCNA complex. From these results, we suggest a novel role of the CAF-1–PCNA complex during the meiotic pro- phase together with the meiosis-specific recombinase, Lim15/Dmc1. Discussion In this study, we identified CcCac1L as a novel interacting partner of CcLim15. Furthermore, it was shown that CcCac1L interacts with CcPCNA during the meiotic prophase. Several DNA synthesis events take place during the meiotic prophase, even after genome-wide replication at the premeiotic S phase [32,34]. In the current model, DNA synthesis is required in the molecular events of meiotic recombi- nation [35,36]. Meiotic DSBs are processed to single- strand overhangs, followed by single-strand invasion to the other allele. Recombination results in either crossover products (exchanging the flanking DNA arms between homologues) or non-crossover products (non-exchange of DNA arms). Both pathways accompany DNA synthesis following recombination [35,36]. Given the coordination of CAF-1 and PCNA in various DNA synthesis events, a CAF-1–PCNA complex may be involved in chromatin assembly fol- lowing DNA synthesis events during the meiotic pro- phase. Based on the current model, we propose the role of the CAF-1–PCNA complex during meiosis (Fig. 4). PCNA recruits DNA polymerase at the end of single-strand regions that are coated by Lim15/Dmc1 (Fig. 4A,B). Consistent with this model, DNA polymerases and DNA ligases are active dur- ing this stage [37–40]. After DNA synthesis, CAF-1 is recruited to the site of the Lim15/Dmc1–PCNA complex and deposits histone H3 (or a histone vari- ant) and H4 on the naked DNA to restore the nucleosome structure (Fig. 4C). Because of the vari- ous interactions of Lim15/Dmc1–CAF-1–PCNA, we suggest that they act in multiple ways at the site of meiotic recombination and contribute to the subse- quent assembly of chromatin. Therefore, there may be coordination between meiotic recombination and CAF-1-dependent nucleosome assembly before the resolution of Holliday junctions (Fig. 4C). The CAF-1–PCNA complex senses DNA damage and subsequently contributes to chromatin assembly at the site of DNA repair [33], including nucleotide excision repair [28] and DSB repair [29,30]. During the process of chromatin assembly, CAF-1 deposits new H3.1 histones on the site of repair-associated DNA synthesis without the recycling of parental histones; therefore, CAF-1-dependent chromatin assembly results in a chromatin memory of damage at a repair site [41]. Similarly, CAF-1 may establish a chromatin memory at the site of DNA synthesis A B C Fig. 3. Interaction between CcCac1L and CcPCNA during meiosis. (A, B) Co-immunoprecipitation of CcCac1L and PCNA in the cell extract at the meiotic prophase; 20 mg of cell extract was incu- bated with anti-CcPCNA IgG, anti-CcCac1L IgG or control rabbit serum-conjugated beads. After washing the beads, the bound proteins were eluted and analysed by western analysis with anti- PCNA IgG (A) or anti-CcCac1L IgG (B). Lane 1, 100 lg of crude extract was loaded. (C) Detection of SPR using a Biacore assay. Truncation mutants of CcCac1L were injected onto a CcPCNA conjugated chip. The binding affinity is inversely related to the dissociation constant (K D ), which is a ratio of the dissociation (K d ) and association (K a ) rates (K D = K d /K a ). ND, not detected. Link between Lim15/Dmc1 and the CAF-1–PCNA complex S. Ishii et al. 2036 FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS following meiotic recombination. The site of cross- over recombination becomes the chiasma, required for the appropriate segregation of homologous chro- mosomes. Chiasma formation involves the coordi- nated local change of DNA and the surrounding chromatin environment [42]. One tantalizing possibil- ity is that CAF-1-dependent chromatin memory directs chiasma formation to newly synthesized DNA at the site of recombination. CAF-1-dependent his- tone deposition is an established key early step for chromatin organization in mitosis [19,24–26]. Multi- ple steps are involved in organizing the chromatin structure after histone deposition by CAF-1. There- fore, the CAF-1–PCNA complex may be the central player establishing the memory of recombination, leading to unique nuclear organization during meiosis. Materials and methods Culture of C. cinerea and collection of fruiting bodies The basidiomycete Coprinopsis cinerea (Coprinus cinereus) (strain #56838) was purchased from the American Type Culture Collection (ATCC), Manassas, VA, USA. The culture methods and procedures for the photoinduction of meiosis were performed as described previously [38,43]. Yeast two-hybrid screening The C. cinerea cDNA library in meiotic tissues was con- structed using a Time Saver cDNA Synthesis Kit (GE Healthcare UK Ltd, Little Chalfont, UK). Yeast two-hybrid screening was carried out using the MATCH- MAKER GAL4 Two-Hybrid System 3 (Clontech, Moun- tain View, CA, USA). The cDNA encoding full-length CcLim15 was fused in-frame with the GAL4 DNA-binding domain in the pBKDT7 vector as bait. The cDNA library was subsequently cloned into the pGADT7 vector encoding the GAL4 activation domain, and used as prey in the two- hybrid experiments. Both the GAL4 fusion bait and the prey plasmids were transformed into the yeast strain, AH109 (Clontech), by standard lithium acetate transforma- tion. Putative interacting clones were subsequently isolated based on their ability to activate the expression of the GAL4 selectable marker genes, thus producing growth on SD minimal medium lacking adenine, histidine, leucine and tryptophan (SD4: –Ade/–His/–Leu/–Trp). To confirm galactosidase activity, colonies that grew under this selective condition were plated onto SD4 medium with X-a-galacto- sidase. Purified plasmids from yeast clones were electropo- rated into Escherichia coli DH10B. After the plasmid DNA had been prepared, the cDNA inserts were sequenced and the corresponding gene was identified by blast analysis. cDNA cloning of CcCac1L One of the interacting factors identified in our screen was found to encode the CcCac1L C-terminus, consisting of the amino acid region 382–812 (CcCac1L-C) (Fig. 1B). To obtain the full-length CcCac1L cDNA, 5¢RNA ligase-medi- ated-RACE (5¢RLM-RACE) (Ambion, Austin, TX, USA) and 3¢RLM-RACE (Invitrogen, Carlsbad, CA, USA) experiments were performed, each according to the manu- facturer’s protocol. The DDBJ/EMBL/GenBank accession number of the nucleotide sequence for CcCac1L reported in this study is AB074897. A B C Fig. 4. Model of chromatin assembly following meiotic recombina- tion. (A) After DSB formation, Lim15/Dmc1 coats the single-strand end during strand invasion. (B) PCNA recruits the DNA polymerase to the site of Lim15/Dmc1. The broken line represents newly syn- thesized DNA. (C) CAF-1 forms a complex with Lim15/Dmc1 and PCNA. CAF-1 deposits histones H3 and H4 or other factors, such as histone variants (indicated as ‘?’), on the newly synthesized DNA. S. Ishii et al. Link between Lim15/Dmc1 and the CAF-1–PCNA complex FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS 2037 Two-hybrid assay To confirm the direct interaction between proteins or pro- tein fragments, the appropriate bait and prey constructs were co-transformed into yeast cells, and two-hybrid assays were performed using the MATCH-MAKER Kit (Clon- tech), according to the manufacturer’s instructions. The full-length CcLim15, CcCac1L, CcCac1L-N and CcCac1L- C fragments were cloned into pGADT7 and pGBKT7. The vector pairs indicated in Fig. 1C were co-transformed into the yeast strain AH109. Controls for self-activating fusion proteins were carried out in each of these assays by trans- formation of specific expression constructs with a pGBKT7 or pGADT7 empty vector. Transformants were then plated onto three types of selection medium: SD2, –Leu/–Trp; SD3, –His/–Leu/–Trp; SD4, –Ade/–His/–Leu/–Trp. b-Galactosidase assays were performed in chlorophenol red-b-d-galactopyranoside (CPRG)-based liquid culture using the individual colonies that grew in SD3 medium, according to the Yeast Protocols Handbook (Clontech). Northern blotting Northern blotting was performed as described previously [44]. The region of the CcCac1L cDNA corresponding to 1146–2346 bp was used as a probe. Antibodies A polyclonal antibody against the CcCac1L protein was raised in rabbit and rat using the purified 382–812 amino acid fragment expressed as a His-CcCac1L-C protein in E. coli. The specificity of the antibodies was confirmed by western analysis as described previously [44,45]. A poly- clonal antibody against CcLim15 was also raised as described previously [45]. Anti-CcPCNA IgGs and purified recombinant His-tagged CcPCNA (His-CcPCNA) have been described previously [44]. In vivo co-immunoprecipitation Rabbit anti-CcCac1L polyclonal IgGs rabbit anti- CcLim15 polyclonal IgG or control rabbit serum was coupled with CNBr-activated sepharose beads, according to the manufacturer’s instructions {20 mg aliquots of crude extracts from meiotic tissues were prepared in buf- fer D [buffer C, as described below, with 0.6 m NaCl and protease inhibitors (1 mm phenylmethanesulfonyl fluoride, 1 lm leupeptin and 1 lm pepstatin A)]}. The extracts in buffer D were then incubated with either 70 lL of pri- mary antibody or with control rabbit serum-conjugated beads for 1 h at 4 °C. The beads were then collected by centrifugation at 800 g for 30 s. After resuspension of the beads in buffer E (0.15 m NaCl in buffer D), the superna- tant was removed by centrifugation at 9100 g for 30 s. The bound material was eluted from the beads with 20 lL of buffer F (50 mm glycine/HCl, pH 2.5, and 0.01% Triton X-100). After neutralization of the pH by the addition of 1 m Tris/HCl, pH 7.5, the bound material was analysed by immunoblotting with either anti-CcCac1L or anti-CcLim15 IgG, both at a dilution of 1 : 1000. To test the interaction between CcCac1L and CcPCNA in vivo, anti-CcCac1L and anti-CcPCNA IgGs were used and in vivo immunoprecipita- tion experiments were performed as described previously [44]. The CcCac1L cDNA corresponding to 1146–2346 bp was used as a probe. Immunostaining of nuclei of C. cinerea meiotic cells Immunostaining of nuclei of C. cinerea meiotic cells was performed as described previously [38]. A 1 : 100 dilution was used of both rabbit anti-CcLim15 and rat anti- CcCac1L primary IgGs. We also employed a 1 : 1000 dilu- tion of both anti-rabbit IgG conjugated with Alexa Fluoro 488 (Invitrogen) for anti-CcLim15 and anti-rat IgG conju- gated with Alexa Fluoro 568 (Invitrogen) for anti-CcCac1L as secondary antibodies. Proteins A truncated cDNA corresponding to the N-terminus (resi- dues 1–381, as shown in Fig. 1B) of CcCac1L (CcCac1L-N) was cloned into the Bam HI and NotI sites of the expression vector pET21a(+) (Novagen, Gibbstown, NJ, USA). The C-terminal insert of CcCac1L (CcCac1L-C, residues 382– 812) was cloned into the NcoI and XhoI sites of the pET21d(+) expression vector (Novagen). The following primer pairs were used for subsequent PCR amplification of these cDNAs. CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT. CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG. To over- express N-terminal hexahistidine-tagged CcCac1L-N (His-CcCac1L-N) and CcCac1L-C (His-CcCac1L-C), E. coli BL21 cells (DE3) (Novagen) carrying the expression plasmid for each gene were grown in 2 · YT medium (16 gÆL )1 poly- peptone, 10 gÆL )1 yeast extract, 5 gÆL )1 NaCl) containing 1 lgÆmL )1 ampicillin at 37 °C. After reaching an absorbance at 600 nm of 0.6, isopropyl thio-b-d-galactoside (IPTG) was added to these cultures at a final concentration of 1 mm, and the cells were incubated for an additional 5 h at 25 °C. The bacterial cells were then harvested by centrifugation at 4500 g for 15 min, and the resulting cell pellet was resus- pended in 15 mL of ice-cold buffer A [20 mm Tris/HCl, pH 7.9, 10% glycerol, 0.5 m NaCl, 5 mm imidazole con- taining protease inhibitors (1 mm phenylmethanesulfonyl Link between Lim15/Dmc1 and the CAF-1–PCNA complex S. Ishii et al. 2038 FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS fluoride, 1 lm leupeptin and 1 lm pepstatin A)]. The cells were then lysed by the addition of 1 mgÆmL )1 lysozyme, stir- red on ice for 30 min and sonicated. Insoluble material was removed by centrifugation at 26 000 g for 15 min. Proteins were loaded onto a 5 mL Hi-trap chelating column (GE Healthcare UK Ltd.), and bound proteins were eluted with a 20 mL linear gradient of 0.05–1 m imidazole in buffer B (buffer A with 0.1% Nonidet P40). The eluted protein frac- tion was then dialysed against buffer C (50 mm Tris/HCl, pH 7.5, 0.05 m NaCl, 1 mm EDTA, 5 mm 2-mercaptoetha- nol, 10% glycerol, 0.1% Nonidet P40), and the dialysate was loaded onto a heparin column (GE Healthcare UK Ltd.) equilibrated with 0.05 m NaCl in buffer B. After washing, fractions were collected with a 20 mL linear gradi- ent of 0–0.5 m NaCl in buffer B. The eluted protein was then dialysed against 0.05 m NaCl in buffer B, and loaded onto a MonoQ HR5/5 column (GE Healthcare UK Ltd). After washing, the fractions were again collected with 20 mL of a linear gradient of 0–0.5 m NaCl in buffer B. Fractions containing the recombinant proteins were verified by SDS-PAGE, pooled and then dialysed against storage buffer (NaCl/P i , pH 7.4, 50% glycerol). Recombinant His- tagged CcLim15 (His-CcLim15) was expressed in E. coli and purified as described previously [31]. Surface plasmon resonance Analysis of both His-CcCac1L-N and His-CcCac1L-C binding to His-CcPCNA was performed using a BIAcore Biosensor instrument (GE Healthcare Bio-Sciences, Uppsala, Sweden), according to the manufacturer’s proto- col. A sensor chip (CM 5 research grade) was activated by the N-hydroxysuccinimide/N-ethyl-N¢-(dimethylaminopro- pyl)carbodiimide coupling reaction, and 55 lL of coupling buffer (10 mm sodium acetate, pH 4.0) containing the His-CcPCNA protein (625 nm) was injected over the chip at a rate of 20 lLÆmin )1 . His-CcPCNA was covalently bound to the sensor chip surface via carboxyl moieties on the dextran. Unreacted N-hydroxysuccinimide ester groups were inactivated using 1 m ethanolamine/HCl (pH 8.0). HBS-EP buffer (10 mm Hepes, pH 7.4, 150 mm NaCl, 3mm EDTA, 0.005% Tween 20) was passed continuously over the sensor chip. The binding levels were measured in resonance units (RU); 1000 RU of protein corresponds to a surface concentration alteration of approximately 1ngÆmm )2 [46]. In this experiment, approximately 6600 RU of His-CcPCNA was immobilized onto the chip surface. The binding of His-CcPCNA to either His-CcCac1L-N or His-CcCac1L-C was performed in a reaction containing 20 lL of HBS-EP buffer with three different concentrations of His-CcCac1L-N or His- CcCac1L-C (250 nm, 500 nm or 1 lm). The running buffer (HBS-EP buffer) flow rate was 5 lLÆmin )1 at 37 °C. All data were monitored and analysed using the manufac- turer’s software (GE Healthcare Bio-Sciences). Acknowledgements We thank Montserrat Anguera, Jennifer Erwin and Janice Ahn for critical reading of the manuscript, and all members of Sakaguchi Laboratory for help and dis- cussions. S. H. N. is a research fellow of the Japan Society for Promotion of Science. References 1 Kleckner N (2006) Chiasma formation: chromatin/axis interplay and the role(s) of the synaptonemal complex. Chromosoma 115, 175–194. 2 Masson JY & West SC (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship. Trends Biochem Sci 26, 131–136. 3 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K (2005) Knockdown of LIM15/DMC1 in the mushroom Coprinus cinereus by double-stranded RNA-mediated gene silencing. Microbiology 151, 3669–3678. 4 Neale MJ & Keeney S (2006) Clarifying the mechanics of DNA strand exchange in meiotic recombination. Nature 442, 153–158. 5 Villeneuve AM & Hillers KJ (2001) Whence meiosis? Cell 106, 647–650. 6 Bishop DK (1994) RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79, 1081–1092. 7 Tarsounas M, Morita T, Pearlman RE & Moens PB (1999) RAD51 and DMC1 form mixed complexes asso- ciated with mouse meiotic chromosome cores and syn- aptonemal complexes. J Cell Biol 147, 207–220. 8 Shinohara M, Gasior SL, Bishop DK & Shinohara A (2000) Tid1/Rdh54 promotes colocalization of rad51 and dmc1 during meiotic recombination. Proc Natl Acad Sci USA 97, 10814–10819. 9 Chen YK, Leng CH, Olivares H, Lee MH, Chang YC, Kung WM, Ti SC, Lo YH, Wang AH, Chang CS et al. (2004) Heterodimeric complexes of Hop2 and Mnd1 function with Dmc1 to promote meiotic homolog juxta- position and strand assimilation. Proc Natl Acad Sci USA 101, 10572–10577. 10 Enomoto R, Kinebuchi T, Sato M, Yagi H, Kurumi- zaka H & Yokoyama S (2006) Stimulation of DNA strand exchange by the human TBPIP/Hop2-Mnd1 complex. J Biol Chem 281, 5575–5581. 11 Petukhova GV, Pezza RJ, Vanevski F, Ploquin M, Masson JY & Camerini-Otero RD (2005) The Hop2 and Mnd1 proteins act in concert with Rad51 and Dmc1 in meiotic recombination. Nat Struct Mol Biol 12, 449–453. 12 Hayase A, Takagi M, Miyazaki T, Oshiumi H, Shinohara M & Shinohara A (2004) A protein complex containing Mei5 and Sae3 promotes the assembly of the S. Ishii et al. Link between Lim15/Dmc1 and the CAF-1–PCNA complex FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS 2039 meiosis-specific RecA homolog Dmc1. Cell 119, 927– 940. 13 Tsubouchi H & Roeder GS (2004) The budding yeast mei5 and sae3 proteins act together with dmc1 during meiotic recombination. Genetics 168, 1219–1230. 14 Neyton S, Lespinasse F, Moens PB, Paul R, Gaudray P, Paquis-Flucklinger V & Santucci-Darmanin S (2004) Association between MSH4 (MutS homologue 4) and the DNA strand-exchange RAD51 and DMC1 proteins during mammalian meiosis. Mol Hum Reprod 10, 917– 924. 15 Habu T, Wakabayashi N, Yoshida K, Yomogida K, Nishimune Y & Morita T (2004) p53 Protein interacts specifically with the meiosis-specific mammalian RecA- like protein DMC1 in meiosis. Carcinogenesis 25, 889– 893. 16 Iwabata K, Koshiyama A, Yamaguchi T, Sugawara H, Hamada FN, Namekawa SH, Ishii S, Ishizaki T, Chiku H, Nara T et al. (2005) DNA topoisomerase II interacts with Lim15/Dmc1 in meiosis. Nucleic Acids Res 33, 5809–5818. 17 Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homo- log, Lim15/Dmc1, via interaction with the small ubiqu- itin-related modifier (SUMO)-conjugating enzyme Ubc9. Febs J 273, 4003–4012. 18 Hamada FN, Koshiyama A, Namekawa SH, Ishii S, Iwabata K, Sugawara H, Nara TY, Sakaguchi K & Sawado T (2007) Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homo- logue, Lim15/Dmc1, but does not stimulate its strand transfer activity. Biochem Biophys Res Commun 352, 836–842. 19 Kaufman PD, Kobayashi R, Kessler N & Stillman B (1995) The p150 and p60 subunits of chromatin assembly factor I: a molecular link between newly synthesized histones and DNA replication. Cell 81, 1105–1114. 20 Kaufman PD, Kobayashi R & Stillman B (1997) Ultra- violet radiation sensitivity and reduction of telomeric silencing in Saccharomyces cerevisiae cells lacking chro- matin assembly factor-I. Genes Dev 11, 345–357. 21 Tyler JK, Collins KA, Prasad-Sinha J, Amiott E, Bulger M, Harte PJ, Kobayashi R & Kadonaga JT (2001) Inter- action between the Drosophila CAF-1 and ASF1 chro- matin assembly factors. Mol Cell Biol 21, 6574–6584. 22 Verreault A, Kaufman PD, Kobayashi R & Stillman B (1996) Nucleosome assembly by a complex of CAF-1 and acetylated histones H3/H4. Cell 87, 95–104. 23 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Still- man B & Araki T (2001) FASCIATA genes for chro- matin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems. Cell 104, 131– 142. 24 Gaillard PH, Martini EM, Kaufman PD, Stillman B, Moustacchi E & Almouzni G (1996) Chromatin assem- bly coupled to DNA repair: a new role for chromatin assembly factor I. Cell 86, 887–896. 25 Smith S & Stillman B (1989) Purification and character- ization of CAF-I, a human cell factor required for chro- matin assembly during DNA replication in vitro. Cell 58, 15–25. 26 Stillman B (1986) Chromatin assembly during SV40 DNA replication in vitro. Cell 45, 555–565. 27 Shibahara K & Stillman B (1999) Replication-depen- dent marking of DNA by PCNA facilitates CAF-1-cou- pled inheritance of chromatin. Cell 96, 575–585. 28 Green CM & Almouzni G (2003) Local action of the chromatin assembly factor CAF-1 at sites of nucleotide excision repair in vivo. EMBO J 22 , 5163–5174. 29 Linger J & Tyler JK (2005) The yeast histone chaperone chromatin assembly factor 1 protects against double- strand DNA-damaging agents. Genetics 171, 1513–1522. 30 Nabatiyan A, Szuts D & Krude T (2006) Induction of CAF-1 expression in response to DNA strand breaks in quiescent human cells. Mol Cell Biol 26, 1839–1849. 31 Nara T, Yamamoto T & Sakaguchi K (2000) Charac- terization of interaction of C- and N-terminal domains in LIM15/DMC1 and RAD51 from a basidiomycete, Coprinus cinereus. Biochem Biophys Res Commun 275, 97–102. 32 Hotta Y, Ito M & Stern H (1966) Synthesis of DNA during meiosis. Proc Natl Acad Sci USA 56, 1184–1191. 33 Moggs JG, Grandi P, Quivy JP, Jonsson ZO, Hubscher U, Becker PB & Almouzni G (2000) A CAF-1–PCNA- mediated chromatin assembly pathway triggered by sensing DNA damage. Mol Cell Biol 20, 1206–1218. 34 Lu BC & Jeng DY (1975) Meiosis in Coprinus VII. The prekaryogamy S-phase and the postkaryogamy DNA replication in C. lagopus. J Cell Sci 17, 461–470. 35 Allers T & Lichten M (2001) Differential timing and control of noncrossover and crossover recombination during meiosis. Cell 106, 47–57. 36 Hunter N & Kleckner N (2001) The single-end invasion: an asymmetric intermediate at the double-strand break to double-Holliday junction transition of meiotic recom- bination. Cell 106, 59–70. 37 Namekawa S, Hamada F, Ishii S, Ichijima Y, Yamagu- chi T, Nara T, Kimura S, Ishizaki T, Iwabata K, Ko- shiyama A et al. (2003) Coprinus cinereus DNA ligase I during meiotic development. Biochim Biophys Acta 1627, 47–55. 38 Namekawa S, Hamada F, Sawado T, Ishii S, Nara T, Ishizaki T, Ohuchi T, Arai T & Sakaguchi K (2003) Dissociation of DNA polymerase alpha-primase com- plex during meiosis in Coprinus cinereus. Eur J Biochem 270, 2137–2146. 39 Sakaguchi K & Lu BC (1982) Meiosis in Coprinus: characterization and activities of two forms of DNA Link between Lim15/Dmc1 and the CAF-1–PCNA complex S. Ishii et al. 2040 FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS polymerase during meiotic stages. Mol Cell Biol 2, 752– 757. 40 Sawado T & Sakaguchi K (1997) A DNA polymerase alpha catalytic subunit is purified independently from the tissues at meiotic prometaphase I of a basidiomy- cete, Coprinus cinereus. Biochem Biophys Res Commun 232, 454–460. 41 Polo SE, Roche D & Almouzni G (2006) New histone incorporation marks sites of UV repair in human cells. Cell 127, 481–493. 42 Blat Y, Protacio RU, Hunter N & Kleckner N (2002) Physical and functional interactions among basic chro- mosome organizational features govern early steps of meiotic chiasma formation. Cell 111, 791–802. 43 Nara T, Saka T, Sawado T, Takase H, Ito Y, Hotta Y & Sakaguchi K (1999) Isolation of a LIM15/DMC1 homolog from the basidiomycete Coprinus cinereus and its expression in relation to meiotic chromosome pair- ing. Mol Gen Genet 262, 781–789. 44 Hamada F, Namekawa S, Kasai N, Nara T, Kimura S, Sugawara F & Sakaguchi K (2002) Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinere- us. Alternative truncation and expression in meiosis. Eur J Biochem 269, 164–174. 45 Nara T, Hamada F, Namekawa S & Sakaguchi K (2001) Strand exchange reaction in vitro and DNA- dependent ATPase activity of recombinant LIM15/ DMC1 and RAD51 proteins from Coprinus cinereus. Biochem Biophys Res Commun 285, 92–97. 46 Wong CW, Komm B & Cheskis BJ (2001) Structure– function evaluation of ER alpha and beta interplay with SRC family coactivators. ER selective ligands. Biochemistry 40, 6756–6765. S. Ishii et al. Link between Lim15/Dmc1 and the CAF-1–PCNA complex FEBS Journal 275 (2008) 2032–2041 ª 2008 The Authors Journal compilation ª 2008 FEBS 2041 . Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis Satomi. meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and Satoshi H. Namekawa Department of Applied