a stepwise actor based approach to the establishment of science industry co operations
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... supplementary material is available: Fig S1 Application of a simple 2D IEF ⁄ SDS ⁄ PAGEbased protease proteomic approach in substrate finding 2D IEF ⁄ SDS ⁄ PAGE -based image analyses of the second quadrant ... residues, variable oxidation of methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides ... PAGE -based image analyses of the third quadrant Fig S3 2D IEF ⁄ SDS ⁄ PAGE -based image analyses of the fourth quadrant This supplementary material can be found in the online version of this article...
- 20
- 506
- 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf
... Hyderabad, India, January William A Woods 1970 Transition network grammars for natural language analysis Communications of the ACM, 13(10):591–606, October Gerald Gazdar 1988 Applicability of indexed ... mechanism in much the same way I assume that there are four modes of memory operations according to direction and allowance of memory operations as in Table The modes can be organized into the ... with variable quantification to resolve pro-forms and VP ellipses to their antecedents The variable quantification in TLG is comparable to the use of memory in storing antecedents and anaphora The...
- 9
- 572
- 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt
... 200 scans, 512 K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum ... through the cathode heater was set to 2.2 A The cathode surface potential was )1 V and the anode potential was 10 V Both end-plate potentials of the ion trap were set at 1.5 V and the duration of the ... discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which corresponded...
- 7
- 491
- 0
báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx
... potato BAC AC233501.1 Representation of the co- linearity between the tomato BAC CU914524.3 and the potato BAC AC233501.1 The BAC CU914524.3 from tomato and the BAC AC233501.1 from potato are present ... from Solanaceae and Rubiaceae mapped along the genomes of two of the major representatives of the family will support comparative genomics approaches aimed at addressing the most fundamental issues ... sylvestris; NICAT: N attenuata; NICLS: N langsdorffii × N sanderae; CAPAN: C annuum; CAPCH: C chinense; PETHY: Petunia × hybrida; COFCA: C canephora; COFAR: C arabica.CAB: Computer Aided Bioscience...
- 16
- 298
- 0
Báo cáo y học: "A BAC clone fingerprinting approach to the detection of human genome rearrangements" docx
... Additional data files 13 The following additional data are available with the online version of this paper Additional data file provides additional details about the algorithms used to evaluate ... basis of the reconstruction fraction, defined as the total size of all alignments in the combination relative to the average fingerprint size of the clone The highest scoring combination of alignments ... bioinformatics leads, project management JS: laboratory lead, project management MM, CC: principal investigator, laboratory lead, project management All authors have read and approved the final manuscript...
- 17
- 285
- 0
Báo cáo sinh học: "A marginal quasi-likelihood approach to the analysis of Poisson variables with generalized linear mixed models" pot
... [3], the quasi-likelihood approach only the specification of the marginal mean vector and of the variance requires 11 covariance matrix V of the vector Y of observations Given the moment generating ... sire, and animal models on one hand, and direct and maternal effects on the other hand A simple example of that is the classical animal model In (a2 ! ) x! p + +pi, for the jth performance of the ith ... that the main advantage of [15] is to provide estimates ofp which can be computed in a similar way as with mixed model equations of Henderson (1984) These equations also imply as a by-product an...
- 7
- 274
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... Vowel Harmony 4, and, of course, reduplication The input consists of the stream of segments and a stream of stressesS: pangupangu Lexical lookup is complicated due to the fact that the surface string ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example...
- 8
- 522
- 0
Báo cáo khoa học: "The "Win-Win" initiative: a global, scientifically based approach to resource sparing treatment for systemic breast cancer therapy" pdf
... this are: For older drugs a) To tailor treatment to patients, community and tumor factors (based on clinical, pathological and biological factors) b) To address economic considerations, cost-effectiveness ... scientific initiative based on cooperation and collaboration of stakeholders; whereby markets are created or maintained for effective cancer therapies, and patients are assured access to these interventions ... thinking and approaches should be encouraged to improve the availability and accessibility of first-line systemic anticancer treatments as part of the comprehensive breast cancer control plan for...
- 5
- 265
- 0
Tài liệu Báo cáo khoa học: "A Novel Feature-based Approach to Chinese Entity Relation Extraction" ppt
... types/subtypes and of the correct order One way to improve the previous feature -based classification approach is to make use of the prior knowledge of the task to find and rectify the incorrect results Table ... is therefore reasonable to conclude that kernel -based especially tree-kernel approaches are not suitable for Chinese, at least at current stage In this paper, we study a feature -based approach ... Jiang, Chengxiang Zhai 2007 A Systematic Exploration of the Feature Space for Relation Extraction In proceedings of NAACL/HLT, pages 113-120 Nanda Kambhatla 2004 Combining Lexical, Syntactic, and...
- 4
- 479
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass cytochromes c through heme staining of a Tris...
- 11
- 731
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... one computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... name The three “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing ... amusing and have a nice ring to them As a matter of fact, it turns out that the name Eatalian is actually used by at least one real Italian restaurant located in Los Angeles, CA3 For the same set of...
- 9
- 518
- 0
Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt
... speech acts be integrated into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties ... initial creation of the situation-type (the first clause), the interpretation of but and the modification of the initial situation-type to accommodate the information in the second clause SPEECH ACTS ... is the guy at the door and the speaker and the relationship of the speaker having told the guy at the door to watch out The word but can be viewed as function mapping situation-types into situatiun-types...
- 4
- 489
- 0
Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc
... Hague for other systems to which we can compare them We take this level of success as an indication of the feasibility of our data-driven, modular approach Additionally, our approach has the advantage ... begin at the first branching node dominating the WH operator, and train a classifier to trace downward from there, eventually predicting the location of the gap At each node we encounter, the classifier ... gaps in their Government & Binding parser, although the grammatical coverage of their system is extremely limited The SRI Core Language Engine (Alshawi, 1992) incorporates a feature -based account...
- 4
- 614
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
... or cover and you must impose the same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Library of Congress ... not only the Messiah and the Son of God but also the Son of Man who will be seated at the right hand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... Jesus, the chief priests (together with the Pharisees’) set a guard at the tomb of Jesus and make it ‘secure’ by sealing the stone After the 18 When Matthew writes of the curtain of the naos being...
- 322
- 436
- 0
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
... scholarship and that of general human behavior Analysis of the different ways that things can be set apart as special and protected by taboos will suggest that the sui generis approach to the study of ... the idea of continuing the conversation about how these things compare and contrast (an international scholarly rationale) In this case we as scholars of religion are making “religion” a second-order ... Preface For reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see as an unbridgeable divide between the humanities and the natural sciences...
- 229
- 1,453
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability ... ẻ as n ® ∞ By using an idea of Cădariu and Radu (see [15]), we will prove the Hyers-Ulam stability of the functional equation related to quadratic forms Theorem 2.3 Assume that satisfies the ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Ỵ X Thus, the mapping F satisfies...
- 7
- 429
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... notice that this time the tolerance mask is always touched by the magnitude response This can be traced back to the fact that, for the SFB, the steps of the tolerance mask are much smaller, not ... in the passband and the transition bands As the objective function to be minimised we adopt a particular representation of the group delay [20], while the stopband magnitude specifications of the ... filter of Section 5.1 such that the distortion function of an oversampling I-channel complex-modulated FIR filter bank according to (11) approximates a constant delay (LP allpass function) At the same...
- 13
- 623
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical ... “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 D G Bourgin, “Classes of transformations and bordering transformations,” ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx
... difference |rab ≡ |ra − |rb with a = b To make contact with the variational analysis given above, this difference can also be read as |rab = |ra + |δra Then compute the minimum of the distance |rab in ... clever way to extract information from this matrix without going into involved mathematical analysis The idea is to optimize the above scattering equation using a variation approach (11) together ... is mapped onto one of the multiple NT antennas After filtering and amplification, the signals are launched into the wireless channel At the receiver, the signals are captured by NR antennas and...
- 10
- 548
- 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx
... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... 143–190, 1995 [5] P G˘ vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 [11] J B Diaz and B Margolis, A fixed point theorem of the...
- 9
- 278
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25