... have made a lengthy analysis of how the relative weight of economic and cultural capital (what I call the structure of capital) in the capital of teenagers (or of their families) is retranslated ... performs a truly magical operation, the paradigm of which is the separation between the sacred and the profane according to Durkheim's analysis T h e act of scholastic classification is always, but ... the last chapter of my book, based on the works of historians of education, historians of the State, and historians of ideas This analysis could serve as the basis for a systematic comparison...
... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...
... to the American College of Rheumatology criteria [20]), who were 45–75 years old and who had a manually measured JSW on plain AP pelvic radiograph of 1–4 mm at baseline All patients gave written ... number of sets of radiographs required in each stratum was 25 Radiographic techniques All radiographs were obtained at a standard size of 1/1 with the patient in a weight-bearing position The X-ray ... each patient were read at the same time About 10 sets of radiographs were read during each reading session (60 radiographs) A break was planned during each session so as not to exceed more than...
... stages of my development as an undergraduate, and latter as a graduate as well as a Research Assistant I owe a separate debt of gratitude to Emeritus Prof S.J Doorman, Faculty of Philosophy and ... Mizanur Rashid, Tian Yang and Lu Yi; Mses Archana Sharma, Chen Yu, Tan Kar Lin, Jeanne-Marie Ten Leu-Jiun, Cai Hui, Li II Rationale of the Intangible Suping, Zhang Tianjie and Huang Yan In addition, ... relations as a problematique 3.1 3.2 3.3 3.4 Analysing the view of the world through socio-spatial discourse A faculty of social cognition — a reading/ perspective Spatial analysis and narratology Data...
... government says the average American man eats ten grams of salt a day The American Heart Association advises no more than three grams for healthy people It says salt in the American diet has increased ... about the nature of radar The radar can detect speed besides location of objects Radar use radio as type of waves Radar has improved navigational safety 4.4 Questions Before you start reading something ... extensive reading into the reading curriculum: As a separate stand-alone course; As part of an existing reading course; As a non-credit addition to an existing course; 50 As an extracurricular activity...
... influential newspaper in mainland China It maintains a vast database of news stories, available to search by the public Among other reasons, we chose this website because its articles have similar quality ... Mihalcea and Dan I Moldovan 1999 An automatic method for generating sense tagged corpora In Proceedings of the 16th Conference of the American Association of Artificial Intelligence Rada Mihalcea ... 3346 75 Table 2:Sizes of the training data and the test data, baseline performance, and the results The test data is a binary sense-tagged corpus, the TWA Sense Tagged Data Set, manually produced...
... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc...
... the ability of lexicalized surprisal to explain a significant amount of variance in RT data for naturalistic texts, over and above that accounted for by other low-level lexical factors, such as ... distributional data to learn semantic representations Psychological Review, 116:463–498 R Harald Baayen and Petar Milin 2010 Analyzing reaction times International Journal of Psychological Research, ... probabilistic language model Journal of Machine Learning Research, 3:1137–1155 Marisa Ferrara Boston, John Hale, Reinhold Kliegl, Umesh Patil, and Shravan Vasishth 2008 Parsing costs as predictors of reading...
... purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA) DNA polymerase and DpnI endonuclease were obtained from Stratagene (La Jolla, CA, USA) Rabbit anti-(human IP) serum was purchased ... 5¢-AAGAATTCA CAGGGTCAGCTTGAAATGTCAG-3¢ (reverse), with XhoI and EcoRI sites on the ends The full-length cDNA of IP was obtained from standard PCR amplification, which was performed in a 50 lL reaction ... 264, 16496–16501 Hirata M, Hayashi Y, Ushikubi F, Yokata Y, Kageyama R, Nakanishi S & Narumiya S (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor Nature 349, 617–620 10...
... for translation initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18] It encoded a predicted product of 255 amino acids with a molecular mass of ... may be an artificial event Association of DmPCNA2 with Drosophila DNA polymerases d and e PCNA was originally identified as a DNA sliding clamp for DNA polymerases [22] In humans, PCNA associates ... reagents (Amersham Pharmacia Biotech, Piscataway, NJ) Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits...
... illustrate this idea, consider the case ofa language composed of just two strings, AB and BA, and assume that the eyes can only get noisy information about the identity of one character at a time After ... 3: Mean number of timesteps taken to read a sentence and (natural) log probability of the true identity of the sentence ‘Accuracy’ for a range of values of α and β Values of α are not labeled, ... Optimization of policy parameters Searching directly for optimal values of α and β for our stochastic reading model is difficult because each evaluation of the model with a particular set of parameters...
... as calculated by the reviewers (mean of word recognition and word attack measures; also mean of comprehension measures, mean of spelling measures, and synthetic versus analytic, where applicable), ... Reading and spelling et al. Total instructional time = specific data not N/S – whether supplementary or additional or part replacement etc available (reviewer estimate = approx ... Table 2: Quality assessment of the included RCTs Author, date Reporting of method of allocation Sample size justification Intention to teach analysis Blinded assessment of outcome...
... the abetting cause An artisan can be understood as a midwife rather than an imposer If we think of any maker or craftsman not as a laser beam but as a Michelangelo, as a respecter of the material ... notion of causality operative in Aristotle, or, at least, Aristotle must have had a much broader notion than we Our contemporary understanding of causality basically amounts to this: a cause is what, ... correct translation, as far as grammar is concerned, and a casual reader of the original German might well take the passage in that sense But a Heideggerian text, just like an Aristotelian one,...
... interpretation, and modification of the initial version of this study Author details Department of Differential Equation, Institute of Mathematics and Mechanics-Azerbaijan National Academy of Science, ... equations Nauk Dumka, Kiev, 284 (1984) (Russian) 31 Yakubov, S, Yakubov, Ya: Differential-Operator Equations Ordinary and Partial Differential Equations Chapman and Hall/ CRC, Boca Raton, 568 ... regularized trace of the considered problem will be studied It is clear that because of the appearance of an eigenvalue parameter in the boundary condition at the end point, the operator associated...
... clinical outcomes; a better definition of the cellularity requirement of functional cartilage development; and evaluation of potential harmful effects of local acidosis caused by degradation of ... EB: Articular cartilage repair: basic science and clinical progress A review of the current status and prospects Osteoarthritis Cartilage 2002, 10:432-463 Buckwalter JA, Mankin HJ: Articular cartilage ... important for favorable clinical outcomes In a recent study, Ossendorf and coworkers [23] reported favorable repair of focal articular cartilage defects using a modification of ACI based on autologous...
... middle two of the four stents (adjacent to the haematoma), which appeared to have only mm of overlap Above the level of the haematoma, an apparent perforation of the second thoracic stent was seen ... chest and back pain continued Further laboratory investigations revealed that he was hypercalcaemic with a corrected calcium of 2.77 mmol/l SCTA revealed a haematoma in the left mid-thoracic cavity ... stent-grafting of thoracic aortic disease J Cardiothorac Surg 2006, 12(1):26 Cosin O, Rousseau H, Otal P, Cron C, Chabbert V, Joffre F: Late perforation ofa thoracic aortic Dacron graft by a metallic...
... Physical health monitoring of patients with schizophrenia Am J Psychiatry 2004, 161(8):1334-1349 American Diabetes Association, American Psychiatric Association, American Association of Clinical ... extracted from the VISN 16 data warehouse Data format and content which was stripped of patient identifiers was in compliance with the Health Insurance Portability and Accountability Act (HIPAA) ... within 60 days after the index date A new start episode was defined by receiving a new episode of antipsychotic agent after a medication break of at least 60 days An augmentation episode was defined...