a radial gradient with a transparent center in the top masked layer
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... procedure, a bolus dose of unfractionated heparin (100 U/kg) was injected through the femoral or radial artery sheath, with repeated boli administered as needed to maintain activated and clotting time...
- 6
- 550
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
... Conference was not integrated, and the idea of paying to watch blacks play football sat uneasily in many fans‘ minds Within days of the announcement that the team was coming, a Dallas Morning News ... week The late morning was cast in a slanting light, the anticipation in the air almost palpable The crowd was casually dressed and mostly male, wearing cotton shirts and slacks My father often stopped ... left in the season The players practiced in Hershey, Pennsylvania, and played their remaining games on the road The last practice in Dallas was on November 13th, after which the goal posts and...
- 18
- 466
- 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx
... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... Perera et al 3498 25 25 25 25 27 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 amino amino amino amino amino 15 15 15 15 15 acids acids acids acids acids amino amino amino amino amino acids ... one of crayfish (Astacidea) trypsins and a group that includes trypsins from P argus (Palinura), Brachyura, Penaeoidea, Caridea and Euphausiacea (Fig 5) Although with low bootstrap values, NJ...
- 13
- 474
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... mutagenesis (mCtBP2 .A5 8E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) ... For example, GATA2 KI ⁄ KI mice carrying a Val-to-Gly point mutation in the GATA2 N-terminal zinc finger that ablates the interaction with cofactors of the Friend of GATA (FOG) family have been ... synthase, a PDZ domain-containing protein [22,23] In contrast, CtBP2 is mainly nuclear, due to a specific N-terminal 20 amino acid region containing Lys residues acetylated by P300 [24,2 4a] Finally,...
- 12
- 326
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... in yeast mitochondria J Biol Chem, 272, 21104– 21112 Yamada A, Yamamoto T, Yoshimura Y, Gouda S, Kawashima S, Yamazaki N, Yamashita K, Kataoka M, Nagata T, Terada H et al (2009) Ca(2+)-induced ... [76] Reagents Standard laboratory chemicals, stigmatellin, oligomycin, KCN, ATP, ADP, safranine O, cyclosporin A, potassium Atypical Artemia ANT acetate (prepared from acetic acid and KOH titrated ... obtain 5¢-ends, the cDNA template was amplified with a reverse gene-specific primer (AAGACCACTGAATTCACGCTCAGCAG) and the GeneRacer 5¢-primer To obtain 3¢-ends, cDNA template was amplified with a...
- 15
- 505
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... profound bilateral sensorineural hearing impairment on audiograms Careful medical examinations revealed no clinical features other than hearing impairment DNA was extracted from the peripheral blood ... DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D, Dahl HH, Estivill X, Gasparini P, Hutchin T, Nance WE, Sartorato ... Najmabadi H, Nishimura C, Kahrizi K, Riazalhosseini Y, Malekpour M, Daneshi A, Farhadi M, Mohseni M, Mahdieh N, Ebrahimi A, Bazazzadegan N, Naghavi A, Avenarius M, Arzhangi S, Smith RJ: GJB2 mutations:...
- 7
- 695
- 0
Báo cáo hóa học: " On calculation of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary condition" pot
... Establishment of the problem belongs to AB (advisor) ES obtained the asymptotic formulas for eigenvalues and eigenfunctions All authors read and approved the final manuscript Competing interests The authors ... problem with retarded argument which contains a spectral parameter in the boundary condition Then, under additional conditions (a) and (b) the more exact asymptotic formulas, which depend upon the ... retardation obtained Şen and Bayramov Journal of Inequalities and Applications 2011, 2011:113 http://www.journalofinequalitiesandapplications.com/content/2011/1/113 Authors’ contributions Establishment...
- 9
- 410
- 0
Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition'''' pptx
... 1.3 in the special case was studied in 14 When ρ x ≡ in 1.1 with the spectral parameter appearing in the boundary conditions, the inverse problem on the half-line was considered by Pocheykina-Fedotova ... Also, physical application of the problem with the linear spectral parameter appearing in the boundary conditions on the finite interval was given by Fulton 23 We recall that inverse spectral ... containing an eigenvalue parameter,” SIAM Journal on Applied Mathematics, vol 14, pp 1164–1175, 1966 22 C T Fulton, “Singular eigenvalue problems with eigenvalue parameter contained in the boundary...
- 17
- 289
- 0
Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition" potx
... 1.3 in the special case was studied in 14 When ρ x ≡ in 1.1 with the spectral parameter appearing in the boundary conditions, the inverse problem on the half-line was considered by Pocheykina-Fedotova ... Also, physical application of the problem with the linear spectral parameter appearing in the boundary conditions on the finite interval was given by Fulton 23 We recall that inverse spectral ... containing an eigenvalue parameter,” SIAM Journal on Applied Mathematics, vol 14, pp 1164–1175, 1966 22 C T Fulton, “Singular eigenvalue problems with eigenvalue parameter contained in the boundary...
- 17
- 352
- 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
... cohorts Mainly for the first cohort, pine height depended on the location in the transect 3.3 Tree radial growth and spatial pattern The radial growth of both dead and living pines was fast along the ... Gobat J.-M., Stand structure, invasion and growth dynamics of bog pine (Pinus uncinata var rotundata) in relation to peat cutting and drainage in the Jura Mountains, Switzerland, Can J For Res ... 1880 and 1995 were used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance)...
- 10
- 277
- 0
Báo cáo y học: "Self-rated health showed a consistent association with serum HDL-cholesterol in the cross-sectional Oslo Health Study" pptx
... illnesses only partially explains the association between HDL-C and SRH Time since food intake The fact that the blood samples were not obtained in the fasting state is a limitation in the present ... dependent variable and HDL-C as the independent variable to be investigated The calculations were performed on each sex and age group separately In each analysis, time since food intake and use ... group There was a significant decrease in SRH with increasing age group, and each of the groups had a rating on health that was significantly different from all other groups (p
- 10
- 347
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... from the prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical ... tumor in the body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision ... Immunohistochemically, the cells were MelanA and synaptophysin immunopositive No immunostaining for cytoceratin, chromogranin, EMA and CEA was observed The remaining non-neoplastic adrenal tissue showed...
- 7
- 412
- 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... potentially disease relevant effects in autoimmune diseases such as RA Finally, the paper draws our attention back to IL-16, a cytokine that has been demonstrated at elevated levels in the sera [15,16] ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and ... immunoglobulins Consequently, the data suggest that the local stromal environment in the joint (and based on previous data from the group other organs as well [14]) to a large extent determines the disease...
- 3
- 222
- 0
Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx
... employing QTL analysis in rats, selecting gene candidates has become a recurrent part of the data analysis An important part of the search for candidate genes is checking the available bioinformatic ... points 9.7, CGC ranking 3, manual rating 3), AARS (CGC points 9.2, CGC ranking 5, manual rating 3) and KARS (CGC points 9.2, CGC ranking 5, manual rating 3) Cia17 In total, 30 genes were ranked ... http://ratmap.org/cgc Comparison of manual evaluation with CGC ranking To estimate the ability of the CGC application to rank candidate genes in a fashion similar to human evaluation, an independent manual inspection...
- 8
- 415
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 ... FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 VIC- TCGGGAGTTCGAGACC-MGB SNP5R ACACAGGGTTTCACCATGCT SNP5 allele2 FAM- CGGGAGTTGGAGACC-MGB SNP6F TCCCTACTGTTGTTTCCGCC SNP6 allele1VIC-TGAAGACCCTGGGC-MGB...
- 9
- 559
- 0
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T T G T T A A ... continental breeds (Charolais and Simmental), giving them the capacity to carry more fat at a younger age [10] We hypothesized that the amino acid change from arginine to cysteine is imparting a ... revealed that the thymine allele was associated with fatter carcasses and the C allele with leaner carcasses This is similar to our nding with the BM1500 microsatellite where two of the four alleles...
- 12
- 321
- 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot
... dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally ... cardiac transplantation at ages 33, 34 and 47 respectively These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia ... palliative procedure In all of these patients a VSD was present In patients there was pulmonary stenosis and in a pulmonary atresia In of them an ASD was present In all patients the ventricular...
- 7
- 387
- 0
Báo cáo y học: "Opitz trigonocephaly syndrome presenting with sudden unexplained death in the operating room: a case report" docx
... patient had many of the clinical and anatomic findings typical of OTCS: the dysmorphic face, white matter alteration, as described by Lalatta [4] and by Azimi [5], cerebral hemorrhage [3] and hearing ... 73:484-488 Kaname T, Yanagi K, Chinen Y, Makita Y, Okamoto N, Maehara H, Owan I, Kanaya F, Kubota Y, Oike Y, Yamamoto T, Kurosawa K, Fukushima Y, Bohring A, Opitz JM, Yoshiura K, Niikawa N, Naritomi ... hematuria, cardiac arrhythmia and severe acidosis requiring cardiopulmonary resuscitation Twenty minutes later, he developed a severe intra-vascular coagulation After the autopsy, experts in...
- 3
- 323
- 0
Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf
... hypothetical scenario is accurate, then the recombination event should have changed simultaneously both the iterons and the Rep aa residues interacting with them, thus maintaining the proper matching ... establish a formal distinction between strains with similar RSDs, that represent actual replicating lineages, and replication-incompatible strains, that apparently not What is the function of the DNA-B ... Ruiz-Medrano R: An iteron-related domain is associated to motif in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach Arch...
- 15
- 694
- 0
Báo cáo y học: "A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis" potx
... of the data JLS participated in the data analyses and writing of the manuscript DLK and GSG provided the gDNA samples and demographic information for the cohorts and contributed to the data analyses ... Carolina Lupus (CLU) study African American (AA) and Caucasian participants and for the Systemic Lupus Erythematosus in Gullah Health (SLEIGH) participants Morris et al Arthritis Research & Therapy ... the study, designed the experiments and contributed to all aspects of the data collection and analyses and drafting and editing of the manuscript All authors read and approved of the final manuscript...
- 9
- 268
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose