a quantitative structure activity relationship for the gastroprotective effect of flavonoids evaluated in human colon adenocarcinoma ht 29 cells
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... acquisition and analysis of data and participated in drafting and editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised ... achieved The lack of a standard approach to assessing PA programmes for the elderly makes it difficult to compare the quality of both the planning and the delivery of such programmes In this way, being ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact...
- 30
- 369
- 0
Multi target selection and high throughput quantitative structure activity relationship model development
... established A relational database allows the definition of data structures, storage and retrieval operations and integrity constraints In such a database the data and relations between them are ... which extend the semantics of the C++, Smalltalk and Java object programming languages to provide full-featured database programming capability The combination of the application and database development ... bioinformatics databases, a rational design of architecture will help us to define the scope of the database, focus on certain pharmaceutical problem, and pave the way for the information collection At...
- 142
- 405
- 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol ... Ulam,” Journal of Approximation Theory, vol 57, no 3, pp 268–273, 1989 T M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society,...
- 15
- 362
- 0
Báo cáo sinh học: " A method for the dynamic management of genetic variability in dairy cattle" pot
... parents because they are more protected against within-family drift Second, as a major constraint, the average EBV of the future individuals for an overall combination of many traits of economical importance, ... Matings a j and mating b j remain for final consideration Then, the possible matings assigned to the ordered pair (action 1, action 2) are: a j and a j, b j and b j, a j and b j, b j and a j Each ... further Then, optimal solutions for x are searched in a continuum, using a full analytical approach The final step consists of taking into account practical constraints Practitioners are able (or...
- 22
- 266
- 0
Báo cáo y học: "The counterintuitive effect of multiple injuries in severity scoring: a simple variable improves the predictive ability of NISS" ppt
... CV and MM participated in the statistical analyses FV participated in the conception of the study, participated in the statistical Di Bartolomeo et al Scandinavian Journal of Trauma, Resuscitation ... variables age and NISS was determined with fractional polynomial transformation Max AIS and num_inj were treated as nominal, i.e using dummy or indicator variables A binary variable expressing ... Cesena, Corsi Amedeo - Azienda Usl di Rimini, Fabbri Andrea - Azienda Usl di Forlì, Ferrari Annamaria - Azienda Ospedaliera Santa Maria Nuova di Reggio Emilia, Ferri Enrico - Azienda Ospedaliero-Universitaria...
- 7
- 239
- 0
Developing critical capacities for the efficient use of public investments in infrastructure to support trade and economic development in vietnam
... consultants and contractors involved in investing and delivering infrastructure, as well as in utilizing infrastructure services for trading activities There are four major factors that the thesis ... acquisition and building capacity of local firms A model of the impacts of these factors on the efficient use of public investments in infrastructure was examined and validated Among these factors, ... investments in infrastructure in planning and delivery in Vietnam In addition, the chapter provides an understanding of the planning process at the national level, and major tasks of government agencies...
- 392
- 562
- 0
Exploration of the functional significance of mig 2 in human cancer cell susceptibility to cytotoxic agents and cell growth control a pilot study
... CCTGTACTCGA 5’ 5’ GGA 3’ ddGTP GGACATG GGACATGAG ddATP GGACA GGACATGA ddCTP ddTTP GGAC GGACATGAGC GGACAT GGGACATGATGAGCT CATGAGCT CATGAGC CATGAG CATGA CATG CAT CA C ILLUSTRATION 3-4 Principle of ... full-length of mig-2 cDNA They are: Mig bam F: 5’- AGGATCCGGAAGGAGCCATGGCTCTGGA-3’; Mig xho R: 5’-ACTCGAGCGCAACAGACTAGAACATGGCC-3’ BamHI and XhoI cutting sites were incorporated into the primers for the ... Thus integrins are believed to mediate all their signaling effects by recruiting and activating different intracellular signaling and adaptor proteins ECM binding initiates clustering of integrins...
- 123
- 257
- 0
Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot
... protein (DAP), the deathassociated protein kinase (DAPK2), and the serine/threonine kinase 1 7a (STK1 7A) , a member of the DAP kinaserelated apoptosis-inducing protein kinase family, as well as Volume ... obese WAT place in 15 A sketch of the hypothetical map of pathophysiological interactions taking A sketch of the hypothetical map of pathophysiological interactions taking place in obese WAT Dashed ... important than initially thought in human WAT [45] In addition to macrophages, several other lymphoid cells may synthesize families of cytokines, promoting a local inflammatory state and, thus, affecting...
- 32
- 429
- 0
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc
... probability of Ca2+ channels, either localized in the membranes of intracellular Ca2+ stores or in the plasma membrane Such Ca2+ entry channels in the plasma membrane and Ca2+ release channels in intracellular ... activation of subcellular Ca2+ signalling and the induction of global Ca2+ waves, which occurred in an oscillatory manner [47] In terms of structure activity relationship these data indicate that the ... synthesis of cADPR are still a matter of debate An ADPRC that acts mainly as a cyclizing enzyme has been purified and cloned more than 10 years ago from the ovotestis of Aplysia californica [19,20]...
- 8
- 469
- 0
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... mapping of the linguistic tests to comparisons of quantitative variables was in most cases straightforward, and always at least plausible The analysis of the linguistic tests and their combinations ... presented a quantitative analysis of the performance of measurable linguistic tests for the selection of the semantically unmarked term out of a pair of antonymous adjectives The analysis shows that a ... phases of the system that further analyze these groups and determine their scalar structure An automatic method for extracting polarity information would also be useful for the augmentation of...
- 8
- 442
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... intervals of melting, DT) of DNA and its complexes are presented in Table A quantitative estimate of the binding parameters was obtained by subtracting the values describing the thermal transition of ... width of the transition interval DT was determined as a half-width (i.e width at half height) of the heat absorption curve All values of thermodynamic parameters were calculated for mol base pairs, ... complexes has shown [28] that intercalation and external binding of ligand with DNA, characterized by the parameter r (the number of mol of ligand per mol of base pairs), depend on the ratio of DNA and...
- 8
- 331
- 0
báo cáo khoa học: "Understanding the relationship between the perceived characteristics of clinical practice guidelines and their uptake: protocol for a realist review" doc
... saturation’ can be applied iteratively, by asking after each stage or cycle of searching whether the latest sample of literature has added anything new to our understanding of the intervention and whether ... relatively transparent approach to conducting the review, and allows for the inclusion of both quantitative and qualitative evidence During the analysis phase of the review, we will use realist-review ... (RTA), which can be used for instances when the accounts in an article are similar; refutational analysis, which can be used when the accounts are contradictory and an attempt is made to explain...
- 9
- 415
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
- 11
- 467
- 0
Design, optimization and structure activity relationship study of CD2 derived peptides for immunomodulation
... are transient and the rapid dissociation leads to partner exchange, rather than rebinding of the same CD2-CD58 pairs [40] There are two features of CD2-ligand interface that make it unusual as ... are able to lyse virus-infected or tumor cells displaying foreign Ag on their surface The activated macrophages and NK cells can destroy intracellular pathogens residing in major intracellular ... Phase II clinical trial for Alefacept CD58-IgG1 fusion CD2/CD58 FDA approval for chronic (Amevive®) protein interaction plaque psoriasis Efalizumab anti-CD1 1a humanized LFA-1/ICAM-1 FDA approval...
- 173
- 322
- 0
Computational methods for structure activity relationship analysis and activity prediction
... SAR analysis include various data mining and visualization methods to systematically analyze SARs on a large-scale and ex9 CHAPTER INTRODUCTION tract available SAR information from compound data ... features of the LASSO approach include the addition of topological relationships conveyed in the graphs and the “forward−backward” analysis capacity of scaffold and corresponding compound information, ... [37] Shanmugasundaram, V.; Maggiora, G M Characterizing Property and Activity Landscapes Using an Information-Theoretic Approach In Proceedings of 222nd American Chemical Society National Meeting,...
- 146
- 343
- 0
Structure activity relationship studies on the factor XIIIa inhibitor tridegin
... Substrates of FXIIIa are marked in gray then acts by inhibiting a positive feedback mechanism in the activation of plasmin: Plasmin cleaves fibrin after selected lysine and arginine residues These ... C-terminal lysine residues enhance the formation of plasmin from plasminogen, thereby increasing fibrinolysis 36,68 TAFIa eliminates these C-terminal lysine and arginine residues from the partially ... medicinalis, was already discovered in the beginning of the 20th century Since then, hirudin has been investigated in great detail and is now applied in clinical practice as a thrombin inhibitor A...
- 121
- 480
- 0
EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON
... in the past as something additional and in no way an integral part of the syllabus or examination (p 15) 1.1.1.2 The structuralist approach “This approach is characterized by the view that language ... of test evaluation, the criteria in evaluating a test have been discovered This helps to establish the theoretical backgrounds for actual study in Chapter In Chapter 2, the main part of the thesis, ... used as the qualitative data of the research The organization of the study The study is divided into three parts: Part one: Introduction – is the presentation of basic information such as the rationale,...
- 60
- 718
- 1
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
... Recommendation 6: Create mechanisms for collecting, analyzing, and disseminating information about the current and future markets for accounting professionals and accounting faculty Available information ... something less than an attainable goal 22 A Professional Responsibility A necessary condition for the ready availability of reliable accounting information is a vibrant and robust accounting profession ... education in the United States and Canada supported by the Carnegie Foundation for the Advancement of Teaching, the authors of Educating Lawyers: Preparation for the Profession of Law (Sullivan et al...
- 140
- 391
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... negative when the substance on the right is a substrate of the reaction Then the arrow points backward, i.e away from the substance and there is a right-hand factor a equal to )1 In uences of the ... Clarke [22], we linearize the system of Eqn (3) in the vicinity of the steady state We this to investigate the stability of this state In this way we obtain the in uence a small change in the ... of paths through reaction-centered graphs of the type of Graph (these paths may contain parallel and antiparallel arrows) The sign of that element therefore depends on the both the sign and the...
- 11
- 638
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25