a ok 323 03 and a oklahoma 309 06 are sensitive to tamiflu in the enzymatic assay but resistant in mdck culture
Báo cáo khoa học: "Deletions of neuraminidase and resistance to oseltamivir may be a consequence of restricted receptor specificity in recent H3N2 influenza viruses" doc
... cells The HA and NA sequences showed that A/ Oklahoma /323/ 03 is similar to the A/ Fujian/411/02 vaccine strain [8] while A/ Oklahoma/ 1992/05, A/ Oklahoma/ 309/ 06 and A/ Oklahoma/ 483/08 are closely related ... 5'-GGGTCGACGCGTTTGAGCAAAAGCAGGAGTGAAAAT, complementary to nucleotides 1–21 at the 3' end of viral RNA (bolded) preceded by a T3 promoter sequence, and 5'-CGGAATTCATTAACCCTCACTAAAAGTAGAAACAAGGAG for the ... Glycan Array results for A/ OK/ 309/ 06 and A/ OK/ 483/08 Glycan Array results for A/ OK/ 309/ 06 and A/ OK/ 483/08 A/ OK/ 309/ 06 (top panel) was run on CFG Printed Array version 3.0 (320 glycans) while the...
- 15
- 281
- 0
Báo cáo y học: " Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import" pps
... The primers for generation of IN5 0-288 cDNA are IN5 0-HindIIIATG-5'(5'– GCGCAAGCTTGGATAGATGCATGGACAAGTAG-3) and 3' -IN- Asp718 and primers for amplifying IN1 -212 cDNA are IN- HindIII-ATG-5' and IN- 212-XmaI3'(5'-CAATTCCCGGGTTTGTATGTCTGTTTGC-3) ... domain and a Cterminal domain, all of which are required for a complete integration reaction The N-terminal domain harbors an HHCC-type zinc binding domain and is implicated in the multimerization ... using HIV-1 HxBru strain [30] as template and an engineered initiation codon (ATG) was placed prior to the first amino acid (aa) of IN The primers are 5' -IN- HindIII-ATG (5'-GCGCAAGCTTGGATAGATGTTTTTAGATGGAA-3')...
- 15
- 416
- 0
Báo cáo sinh học: " Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" pdf
... dTTP and in the case of some manufacturers to include UNG as a standard reagent in kits The success of this approach for elimination of contaminating amplicon DNA depends on the availability of a ... contaminating DNA could be degraded at the same time that RNA was amplified and quantified by real-time RT-PCR, viral RNA was contaminated with amplicon DNA prior to UNG incubation and RT-PCR amplification ... than the standards that did not contain UNG and were not incubated prior to RT-PCR The yintercept value for the reactions not containing UNG and incubated at 30°C for 20 prior to RT-PCR was intermediate...
- 8
- 678
- 0
báo cáo hóa học:" Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" ppt
... dTTP and in the case of some manufacturers to include UNG as a standard reagent in kits The success of this approach for elimination of contaminating amplicon DNA depends on the availability of a ... contaminating DNA could be degraded at the same time that RNA was amplified and quantified by real-time RT-PCR, viral RNA was contaminated with amplicon DNA prior to UNG incubation and RT-PCR amplification ... than the standards that did not contain UNG and were not incubated prior to RT-PCR The yintercept value for the reactions not containing UNG and incubated at 30°C for 20 prior to RT-PCR was intermediate...
- 8
- 475
- 0
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf
... neuraminidase inhibition assays and haemagglutinin subtyping and real-time PCR for influenza A/ B HGH instigated the evaluation of the one-step RT-PCR assay and sequencing for N subtyping of influenza ... all NA subtypes of influenza A viruses from a range of Mammalian and Avian species The sequence information obtained can be helpful in determining the origin of the influenza virus and can be interrogated ... difference in their nucleoproteins (NP) and matrix proteins (M1) Influenza virus A and B infections are an important cause of morbidity and mortality in humans and in a wide range of animal species...
- 11
- 378
- 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
... GCACCCACTCAACGGTATTGTAC TCCGCCAAGGACTATCATGAC/ CGCAATCAGAGCCCTGTAGAA GGAGCCTGAGCCTACCTTCTC/ GTGTTCGGCCAGGTGGTAGA GAACTGGGTGCTTGATAGGC/ AACCAAAATATCCGGAGTAAAAGA 86/1.93 Sucrose transporter/sucrose-proton symporter ... GGATAACTTCCCTGCCTCAATGA/ TTCTTGTAGCAGCTGAGAGGATCA CATGCGAGTGTCCCTCAATCT/ TCTCTTGCGTTTCTGGCTTAGA CAGCCAGATCTTCACGAGCTT/ GTTCTCGCGCATTGACCATA TGAACCACTTGATCTCTGCGACTA/ CAGCTTGCGGAGGTCTGAGT GAGGGTCGTCAGGATTTGGA/ GCCCTGCACTTACCATCTTTAAG ... are calculated by taking the average of the daily high and low temperature each day compared to a baseline (10°C) Data points are compared relative to the first sampling stage, 208 GDD During the...
- 11
- 376
- 0
Phát hiện và phân biệt chủng virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn bằng phương pháp multiplex RT PCR (reverse transcription polymerase chain reaction)
... [5’ – 3’] CAG CCA GTC AAT CAG CTG TG GAA CGT TCG GTC TGG GTG AG ATC CTC CCT GAA TCT GAC AGG TGG GTG GCA GAA AAG CTG TT GTG TCA ATC AGT GCC ATT GAC C TCC CGT ATT TTC TTG CGC TC GAT GCC ATT TTT CCT ... trình tự nucleotide (nt) amino acid (aa) (%) ORF7 mẫu phân lập so với số chủng đại diện (LV, VR2332, 07QN, JXA1, CH- 1a, IngelvacMLV vaccine, MLV.becta.vaccine, JXA1-R vaccines) 49 Bảng ... lineage số Một vài trình tự Thái Lan Canada thuộc lineage số Dòng độc lực cao Trung Quốc thuộc lineage số Một vài mẫu từ Ý thuộc lineage số số Các chủng vacccine sử dụng đƣợc phân tích Vaccine...
- 79
- 522
- 0
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers doc
... Sequence Assay UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGGAGGUUGUAUAGUU UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGAUUGUAUAGUU AUCACAUUGCCAGGGAUUUCCA AUCACAUUGCCAGGGAUUACCA UCCCUGAGACCCUAACUUGUGA UCCCUGAGACCCUAACUCGUGA ... CAGGTCCAGTTTTTTTTTTTTTTTAACTATGCAACCTACTACCTCT miR-2 0a miR-21 UAAAGUGCUUAUAGUGCAGGUAG UAGCUUAUCAGACUGAUGUUGA ACAGTAAAGTGCTTATAGTGCA TCAGTAGCTTATCAGACTGATG GTCCAGTTTTTTTTTTTTTTTCTACCT CGTCCAGTTTTTTTTTTTTTTTCAAC CAGGTCCAGTTTTTTTTTTTTTTTCTACCTGCACTATAAGCACTTTA ... template gave almost Balcells et al BMC Biotechnology 2011, 11:70 http://www.biomedcentral.com/1472-6750/11/70 5’ 5’ 5’ Page of 11 AAAAAAAAAAAAAAAn PAP AAAAAAAAAAAAAAAn RTase NVTTTTTTTTTTTTTTT Tag...
- 11
- 465
- 0
Báo cáo y học: "Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA" ppsx
... CGCACGGGTGAGTAAGGTA GCTTAACACAAGTTGACTAG Campylobacter jejuni 63°C/30 secs 2.5 70 CGCACGGGTGAGTAAGGTA GTCTTACATAAGTTAGATA Campylobacter concisus 55°C/30 secs 2.0 70 CGCACGGGTGAGTAAGGTA ATACCTCATACTCCTATTTAAC ... for AGTAGTTTACTACTTTGCCG ACTGCTGCCTCCCGTAGGAG Universal (R1 and R2) 58°C/60 secs 1.5 350 CATAACGTCGCAAGACCAAA GTGCAATATTCCCCACTGCT E coli 58°C/45 secs 1.5 187 TTGGGAATAACGGTTGGAAA TGTCTCAGTCCCAGTGTTGG ... that bacterial nucleic acids can be detected in many forms of inflammatory arthropathy (RA, inflammatory osteoarthritis, crystal arthropathy [18]) in addition to ReA, and that organisms associated...
- 8
- 310
- 0
báo cáo khoa học: "Application of in situ reverse trancriptase-polymerase chain reaction (RT-PCR) to tissue microarrays" pot
... bound to PCR products via anti-digoxygenin antibodies, and proved resistant to diffusion, remaining in the same cellular localisation as the original mRNA A persistent problem with the in situ ... immunogold-labelled slide and incubated for thirty minutes The tissue was counter-stained with hematoxylin (Dako Ltd., Glostrup, Denmark) and images were captured by a digital camera attached to a light ... Advantages of in situ hybridisation over direct or indirect in situ reverse transcriptasepolymerase chain reaction for localisation of galanin mRNA expression in rat small intestine and pituitary...
- 5
- 254
- 0
Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc
... Purification and biophysical characterization of GSTand NusA-HuR (A) Analysis of the expression and purification of GSTHuR by SDS PAGE Lanes and illustrate total protein and total soluble protein after ... Shift Assays Gel mobility shift assays were used to evaluate the binding interaction between HuR and RNA In these assays, the amount of RNA-bound HuR present in solution is assessed by native ... screen and confirmed the interaction by a homogenous time-resolved fluorescence binding assay The authors mapped the HIV-1 RT-HuR binding sites to the RNase H domain of RT and to the C-terminus...
- 7
- 258
- 0
Báo cáo y học: "Real-time reverse-transcription PCR in the diagnosis of influenza A (H1N1)v in intensive care unit adult patients" pdf
... 19230 The ANZIC Influenza Investigators: Critical care services and 2009 H1N1 influenza in Australia and New Zealand N Engl J Med 2009, 361 [Epub ahead of print] Page of (page number not for citation ... Critical Care Vol 13 No Gimeno and Navarro still suboptimal, is a reasonable alternative to nasopharyngeal swabs, provided that a specific laboratory protocol is followed Our findings alert us to ... Rodríguez A, Ibañez P, Socias L, Cebrian J, Marques A, Guerrero J, Ruiz-Santana S, Marquez E, Del Nogal-Saez F, Alvarez-Lerma F, Martínez S, Ferrer M, Avellanas M, Granada R, Maraví-Poma E, Albert...
- 2
- 331
- 0
DNA, RNA, replication, translation, and transcription
... of DNA • recombinant DNA can be joined to existing DNA using DNA ligase Cloning DNA using bacteria • foreign DNA can be introduced into bacterial cells (transformation) that then will naturally ... tRNA binds at A site through base pairing with mRNA • high-energy covalent bond attaching amino acid is added to growing chain • ribosome shifts over one tRNA unit, placing the tRNA in the P and ... with ubiquitin – a protein that can be attached to proteins to signal that they are destined for degradation The origins of life? The central dogma is so central to all living things, but one wonders...
- 12
- 276
- 0
Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt
... of the associated polymerase domain In the internal cleavage mode, the RNases H behave as typical endonucleases and cleave the RNA along the length of a DNA ⁄ RNA hybrid substrate in the absence ... retroviral RNases H DNA ⁄ RNA hybrids are drawn with RNA strands in red and DNA strands in black In the internal cleavage mode, the arrows mark the sites of cleavage along the length of the hybrid where ... possessing both the polymerase and RNase H domains found in the a subunit, also contains a C-terminal region corresponding to the viral integrase The isolated RNase H domain of M-MLV reverse transcriptase...
- 11
- 296
- 0
Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx
... Sequence(5′ to -3′) AAGGAACTATAGTATGGCGAA CTGTTGCTGGTCTCTTGT TGGACCTACAAATTGCACCAATATAACCTCTTACAGTTGCAAAGTG AAGGACCCAGAGTGATGAGGTATGTATTTTCTTCCTTGGAACTT CTCTTAGCTGCTAGTTCTGAAGC CCCTCGAAAGAATCTATTCAGGG The ... (TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s protocol Total RNA was resuspended in water and quantified by spectrophotometry [5] The RT-LAMP reaction was carried out in ... transcriptase, and µl of template RNA The RT-LAMP reaction mixtures were incubated at the optimal reaction temperature (65°C) for the optimal reaction time (50 min) and were finally heat inactivated...
- 9
- 266
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... ,seniccav dna stset citsongaid rof sdradnats fo launaM seitoozipE seD lanoitanretnI eciffO 17 -36 ,92 ,4002 seneG suriV sniarts aisAnaP rehto dna aeroK ni slamina morf sesuriv esaesid htuom-dna-toof ... revo egatnavda eht evah yam yassa siht ,ralucitrap nI selpmas lacinilc ni suriv DMF fo noitceted elbailer dna etarucca ,dipar eht rof elbatius si yassa RCP -TR T/R detamotua eht taht etartsnomed...
- 6
- 347
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there ... chosen as this was the largest number still within the linear range of the PCR (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts ... QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA in the sample Authors' contributions Heather Jaspan conceived of the study, performed all the...
- 4
- 319
- 0
Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf
... quid are rampant in this area Besides the main risk factors of tobacco, smoking and alcohol, infection by human papillomavirus (HPV) and genetic alterations are likely to play an important role in ... 11(7):646-53 Mehrotra R, Pandya S, Chaudhary AK, Kumar M, Singh M: Prevalence of oral pre-malignant and malignant lesions at a tertiary level hospital in Allahabad, India Asian Pac J Cancer Prev 2008, ... helped to draft the manuscript MS, ACB and RM participated in coordination of the study All authors read and approved the final manuscript Competing interests The authors declare that they have no...
- 10
- 453
- 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot
... phenotyping and staging assay TS participated in B-LCL phenotyping, staging, and fusion assay TC participated in staging and fusion assay AH participated in in vivo correlation studies All authors have ... was to preincubate resistant B-LCL with nonreplicating virus-like particles (VLPs) which contain intact viral capsid In doing so we should saturate a capsid binding factor and reverse the dominant ... a resistant /sensitive cell fusion was resistant to SIV infection (Fig 6) These data suggest that a dominant factor exists in resistant B-LCL that can inhibit SIV replication To determine if a...
- 11
- 340
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
... P3/P4 and P5/P6 were expected to generate a product of 600, 247, 177 bp and 177 bp, respectively CDV vaccine (CDV -A strain) and wild-type strains are maintained in the Harbin Veterinary Research Institute ... (5'-ACGTCCTGGACCCTAAGTTTTG-3') was used as a shared reverse primer P5(5'-GGTTTTATAAAAGATT), p6(5'-ATCTAGAGGTAA-3') were used as the primer specific for different CDV vaccine strains Primer pairs ... CDV vaccine strain After the application of the first-round PCR, primers P2 and P4, and P3, P4, P5 and P6 together, were used to amplify the vaccine and wild-type strains, respectively, at different...
- 6
- 480
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008