... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... C19 9A mutations of Shh were introduced by PCR using primers 5¢-CCTGCAGCAGCGGCAGGCA AGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGG CCGGGGCACACCAG-3¢, and primers 5¢-GGCATGC TGGCTCGCCTGGCTGTGGAAGCA-3¢ and ... indicate that both palmitoylated and nonpalmitoylated mammalian Hh proteins can act as signaling molecules It is notable that while cholesterylation of Hh protein is an intramolecular event catalyzed...
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...
... primer pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, +1405 to +1428 bp) and actin primer pair (5¢-TTCGAGCAG GAGATGGCCACC-3¢ and 5¢-GAGATCCACATCTGYTG GAAGGT-3¢) ... ReverTra Ace (TOYOBO) The cDNA was amplified with TH-specific Regulation of melanin synthesis in insect cuticle primer pair (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, ... protein) Larvae of the armyworm Pseudaletia separata have a relatively simple color pattern composed largely of black and white stripes in the dorsal cuticle that run longitudinally along the body axis...
... 59 Laguna A, Aranda S, Barallobre MJ, Barhoum R, ´ Fernandez E, Fotaki V, Delabar JM, de la Luna S, de ´ la Villa P & Arbones ML (2008) The protein kinase DYRK 1A regulates caspase-9-mediated apoptosis ... Nardone J, Tanasa B, Iuga A, Srikanth S, Okamura H, Bolton D, Feske S, Hogan PG et al (2006) A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulators of NFAT Nature 441, ... protein Catalytic subunit of c-secretase Transmembrane signalling pathway GTPase and cytoskeletal scaffolding protein NAD-dependent protein deacetylase Negative modulator of growth factor-mediated...
... Kume H, Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle Skeletal muscle calpain 32 33 ... Brazil, France, Reunion Island Japan Spain Italy, Mexico, Poland, USA Brazil Japan Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan, Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland, ... Sorimachi H (1998) A novel aspect of calpain activation FEBS Lett 433, 1–4 Sorimachi H, Toyama-Sorimachi N, Saido TC, Kawasaki H, Sugita H, Miyasaka M, Arahata K, Ishiura S & Suzuki K (1993) Muscle- specific...
... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... enzymes that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous...
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... Lai Z, McDonald OB, Stuart JD, Nartey EN, Hardwicke MA, Newlander K, Dhanak D, Adams J, Patrick D, et al: Biochemical characterization of GSK1070916, a potent and selective inhibitor of Aurora...
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... Lai Z, McDonald OB, Stuart JD, Nartey EN, Hardwicke MA, Newlander K, Dhanak D, Adams J, Patrick D, et al: Biochemical characterization of GSK1070916, a potent and selective inhibitor of Aurora...
... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and ... immediate reimplantation of resected bone J Craniomaxillofac Surg 1991, 19:31-39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic...
... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads ... RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was ... G G G G A T C AA G A C A C A T T T G G A G A G G G AA C C T C C C AA C T C G G C C T C T G C C A T C A T T Figure Abundance of each base along the miR-64 2a pre-miR Each experimental condition...
... Domains (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative ... directly estimated from the relevant data set with no need to assay in parallel a large population of identical d-siRNAs For each average F score from each d-siRNA, the calculated CAsH parameter then ... camera with 12-bit readout Thirteen pairs of images (Hoechst and Alexa Fluor® 594 channels) were acquired per well Image analysis was performed using the ImageXpress database and software Images...
... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92,...
... Auto-modification Reg Catalytic domain C Catalytic domain Illustration Functional domains of PARP1 Zn—Zinc-binding domains; NLS— Nuclear localization signal; Casp—Caspase cleavage site; BRCT—BRCA1 C ... by activated PARP1, as PAR can be added onto PARP1 by other members of the PARP family such as the DNA repair enzyme PARP2 PARP1 can also exert its effects as an inactive enzyme For example, acetylation ... various DN damagin agents This activate its enzym NA ng T es matic activit hence ty ication, the resultant P PAR acts as a cue to attract DNA repair com s aA mplexes auto-modifi Continued auto-modification...
... ClassII: ARF4, ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... members at the moment 12 13 human ARF1 human ARF mouse ARF2 mouse ARF2 human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 ... Preparation of RIPA cell lysate Chapter Characterization of Arl1 antibodies and quantification of endogenous Arl1 level 3.1 Generation of rabbit anti rat Arl1 polyclonal antibody 3.2 Characterization...
... disease severity Patients' self-reported smoking status and intensity (that is, pack-years) were noted Data management and analyses Data were analysed using the Statistical Package for Social ... Chicago, IL, USA) A preliminary evaluation of the variables using a Kolmogorov-Smirnov test of normality revealed that none of them required transformation to reach normality Mean ± standard ... gender and pack-group as factors and age and weight as covariates (following stepwise elimination of ESR, CRP, DAS28, HAQ score, and disease duration) revealed a significant effect of pack-group...
... who failed to gain weight after a program of nutritional support also had a worse prognosis [6] Skeletal muscle is a major component of fat free mass and skeletal muscle depletion is itself associated ... using forward stepwise regression analysis including parameters with a p value of < 0.1 by univariate analysis A p value of < 0.05 was taken to be significant Page of (page number not for citation ... – carbon monoxide transfer factor, FRC – functional residual capacity R values are for univariate analysis Mean (SD) *p < 0.05 This study investigated changes in fat free mass and skeletal muscle...
... particular VG participated in the design of the study, data acquisition, analysis and drafting of the manuscript KS, KV and LK participated in data acquisition, analysis and drafting of the manuscript ... al eration it was easily applicable from the day of admission EMS, as an alternative form of exercise, may act as an anabolic stimulus to the muscle reversing the catabolic effects of critical ... polyneuromyopathy in a multidisciplinary intensive care unit Acta Neurol Scand 2008, 118:175-181 Garnacho-Montero J, Amaya-Villar R, Garc a- Garmend a JL, Madrazo-Osuna J, Ortiz-Leyba C: Effect of critical...