a multi agent and climate sensitive tool for risk management in public health
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... Value of Marketing in Public Health and Social Issue Behavior Management Because many managers are not trained formally in marketing, they often tend to neglect key issues that are important in the ... use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management and externalities ... that this shift in focus has occurred in large part because most social marketing managers come from a public health or mass communications background, and few have had broad training in marketing...
- 14
- 780
- 0
After the storm a new era for risk management in financial services
... policy and organisation 19 Credit risk management 16 Operational risk management 13 Integrated risk management 10 Risk data infrastructure Liquidity risk management Asset and liability management ... Credit risk management Investment banking 12 21 Operational risk management 21 Market risk management Private banking/wealth management Capital markets 20 Compliance Broker/dealer 16 Internal audit ... 35 Increasing investment in data and IT infrastructure to enhance risk information 27 Introducing or increasing use of scenarios that take a firm-wide perspective 25 Introducing or increasing...
- 31
- 263
- 0
Rebuilding trust next steps for risk management in financial services
... United States of America 23 United Kingdom Australia India Singapore Canada Netherlands Switzerland France Germany Hong Kong New Zealand Nigeria Sweden China Indonesia Japan Malaysia Spain Other ... risk management in financial services Key points n Institutions are increasingly combining traditional measures of risk management with more forwardlooking tools and techniques n Collecting and analysing ... shortcomings, 62% of survey respondents say that they are increasing investment in data quality and integrity Data quality underpins the efforts that financial institutions are making to aggregate risk...
- 25
- 206
- 0
Too good to fail new challenges for risk management in financial services
... say their organisations are increasing investment in the risk function has fallen slightly across IT, data, training and recruitment Management boards at financial organisations are now paying ... headquartered? (% respondents) United States of America 24 Canada India Singapore Switzerland Australia United Kingdom Germany Indonesia Sweden China Italy Norway Spain Thailand Netherlands Austria ... expertise/knowledge in the organisation 30 Inadequate long-term risk management tools 30 Risk management function lacks authority 23 Inadequate real-time (intra-day) risk management 22 Lack of adequate investment...
- 35
- 183
- 0
Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx
... Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and create a data table Then set the ' data source of the data ... when instantiating ocmdTables After establishing the CommandType as being CommandType.StoredProcedure and then opening the connection, the data reader called odrTables is created by calling the ... You can enhance this tool in several ways: • • • Let users click on multiple tables and automatically create the join Add a list of columns for the user to choose to use for criteria, and allow...
- 10
- 383
- 0
LabelMe: a database and web-based tool for image annotation pdf
... describe LabelMe, a database and an online annotation tool that allows the sharing of images and annotations The online tool provides functionalities such as drawing polygons, querying images, and ... evaluation To achieve this, we developed a web-based tool that allows easy image annotation and instant sharing of such annotations Using this annotation tool, we have collected a large dataset ... shown that performance increases dramatically when more labeled training data is made available One can argue that this is a limitation of current learning techniques, resulting in the recent interest...
- 33
- 515
- 1
Báo cáo khoa học: "A Freely Available Morphological Analyzer, Disambiguator and Context Sensitive Lemmatizer for German" pdf
... Winde Winde Wind Wind Wind Wind winden winden winden winden NOM GEN DAT AKK DAT NOM GEN AKK SIN SIN SIN SIN SIN SIN SIN SIN SIN PLU PLU PLU IPE 1PE 3PE IMP FEM FEM FEM FEM MAS MAS MAS MAS PRA ... with several lemmata Conclusions In this paper, a freely available integrated tool for German morphological analysis, part-ofspeech tagging and context sensitive lemmatization was introduced ... the tagging accuracy is much better for the small tag set, which is an advantage in lemmatization and obviously compensates for the lack of detail I For example the verb fuhren can be either a subjunctive...
- 6
- 287
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
- 11
- 467
- 0
Báo cáo khoa học: "A FRIENDLY AND FLEXIBLE FRONT-END FOR DATA MANAGEMENT SYSTEMS" pptx
... J., Leal, A. , and Shoshanl, A "Semantic Based Parsing and a Natural-Language Interface for Interactive Data Management, " AJCL Microfiche 32, 1975, 58-71 WW'DMS QUERY: INVOKE 'WWDMS/PERSONNEL/ADF' ... The case grammar that it uses allows flexibility in sentence syntax, ungrammatical syntaxj and fast, accurate parsing WHAT ARE THE NAMES AND ADDRESSES OF THE EXECUTIVE SECRETARIES IN R&D? INGRES ... question, map it to data items, and then express the query in a standard language (IL) A translator is written for each data management system in order to rephrase the IL query into the language of...
- 4
- 431
- 0
Báo cáo toán học: " A virtual infrastructure based on honeycomb tessellation for data dissemination in multi-sink mobile wireless sensor networks" pot
... proposing a complete fault-tolerance algorithm that detects routing holes, and calculates and establishes alternative forwarding paths (iv) We evaluate analytically the communication cost and hot ... number of nodes having the packets on a border line In data dissemination and data transfer process, a node in each cell receives and transmits the data e 2NC packet along the diagonal line (i.e., ... region for the queries and the generated data Therefore, it enables the gathering of all of the generated data in the network and permits the performing of certain data optimizations (e.g., data aggregation)...
- 72
- 457
- 0
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc
... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG...
- 7
- 323
- 0
Báo cáo y học: "A functional difficulty and functional pain instrument for hip and knee osteoarthritis" ppsx
... small for the functional domain but greater for the pain domain These DIF findings revealed that the level of pain in certain activities (for example, climbing stairs, squatting, and kneeling) ... calibrations for hip and knee patients and for males and females and incorporate them into future CAT applications This is an approach that we consider interesting for potential future research ... precision was evaluated by calculating and comparing standard errors associated with each subject's score for the 5-, 10-, and 15-item CATs, the full item bank, and the WOMAC Results The average age...
- 12
- 360
- 0
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... prevention and management, symptom management, and diagnostic-related work) from everyday work (housekeeping and repairing, occupational work, child rearing, sentimental work, eating) and biographical ... These include the formal and informal, visible and invisible work that is involved in the engagement, sense-making, and appraisal of illnessrelated practices; they are done both individually and ... psychological mechanisms of behavioural change, may be excessively centred on individuals’ capacity and responsibility to initiate and sustain strategies for self -management and often fail to take into...
- 7
- 331
- 0
Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf
... Critical Care Vol 10 No Struelens and Denis endemic MRSA in The Netherlands and Scandinavia [5,6] Clinical practice recommendations include MRSA carrier screening to inform patient isolation and ... Real-time multiplex PCR on the LightCycler system (Roche Applied Sciences, Indianapolis, IN, USA) has also shown promising performance on testing nasal swabs from neonates and from adult patients ... Mathematical modeling suggest that using a rapid PCR Page of (page number not for citation purposes) assay for MRSA admission screening and patient isolation should reduce significantly the incidence...
- 3
- 221
- 0
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt
... of anxiety and depression) and one way analysis of variance (ANOVA) for associations with happiness, self-rated health, self-rated mental health, worrying about the future, and enjoying life, along ... this article as: Mahfoud et al.: Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children Child and Adolescent Psychiatry and Mental Health ... there was an increase in mental health research in general and among children and adolescents specifically [17] For example, whereas only one research study on the mental health of children and adolescents...
- 7
- 386
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... management and in gerontology), non-PhD academics (1 in PA for the elderly and in sports management) and 21 senior technicians (17 in PA programmes for elderly management and delivery, in quality ... elderly, in sports management, 18 in quality management and in gerontology), non-PhD academics (1 in PA for the elderly and in sports management) and 26 senior technicians (22 in PA programmes for ... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt...
- 30
- 369
- 0
automatic text classification using a multi-agent framework
... selective agent interaction model, called acquaintance lists, where each agent maintains a ranked list of other agents in the agent society Using this acquaintance list model, the authors examined ... Because of these advantages, the multi- agent paradigm has been utilized in designing of information retrieval systems and information management systems However, the applicability of the multi- agent ... The agent coordination research has drawn on various domains including artificial intelligence, social science, game theory, and economics Many agent coordination protocols, such as blackboard and...
- 124
- 136
- 0
Strong, Safe, and Resilient A Strategic Policy Guide for Disaster Risk Management in East Asia and the Pacific
... management and adaptation Liana Zanarisoa Razafindrazay is a Consultant on the East Asia and the Pacific Disaster Risk Management team She specializes in open data and geographic information systems ... disaster risk management work in Jamaica, Mexico, Peru, and Turkey as well as serving as the Regional Coordinator for Disaster Risk Management for Europe and Central Asia Abhas has also served as Advisor ... Insurance Program (DRFI), which aims to mainstream disaster risk financing within the disaster risk management and climate change adaptation agenda Mr Mahul also coordinates the Insurance for...
- 205
- 807
- 0
- development of a terrestrial index of ecological integrity tiei a new tool for ecosystem management
- a rapid method in ecosystem mapping and monitoring as a tool for managing costa rican ecosystem health
- designing a data model and building data objects for customers
- a tool for providing live feed and improving environmental quality for lobster aquaculture in vietnam
- declare a copy constructor and an assignment operator for classes with dynamically allocated memory
- a multi agent model yielding semantic properties
- a tool for causal reasoning in multiagent environments
- thioflavin t stain an easier and more sensitive method for amyloid detection
- a systematic approach to developing contextually culturally and gender sensitive interventions for african american men the example of men 4 health
- 4igenda a multi agent memory assistant
- schizophrenia susceptibility genes in search of a molecular logic and novel drug targets for a devastating disorder
- placing a matrix band and wedge tofflemire matrix for restorations
- a tool for quality management of diabetic pregnancies
- 17designing a multi agent system
- a non destructive and on site tool for control of food quality
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25