thioflavin t stain an easier and more sensitive method for amyloid detection
Báo cáo khoa học: "A Freely Available Morphological Analyzer, Disambiguator and Context Sensitive Lemmatizer for German" pdf
Ngày tải lên :
17/03/2014, 07:20
... resolved correctly (89.9%) When the error-rate is related to the total number of word forms in the text, the accuracy is 99.2% for the large and 99.3% for the small tag set The better performance when ... about 85% accuracy for the large and 96% accuracy for the small tag set The lemmatizer uses the output of the tagger to disambiguate word forms with more than one possible lemma It achieves an ... FEM ATT SUB AKK FEM SIN SZE small tag set PRO PER VER POS ATT SUB SZE Table 2: Tagging example for both tag sets The Lemmatizer For lemmatization (the reduction to base form), the integrated design...
- 6
- 287
- 0
Báo cáo sinh học: " An inexpensive and rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification" pdf
Ngày tải lên :
19/06/2014, 08:20
... comprised the antisense sequence of F1 (23nt), a TTTT linker and a sense sequence of F2 (23nt): 5'CAACAATGCTTCTTGTGATTACA-TTTT-GAACCCG AGGGGACTGCTCGCTT-3' Backward inner primer (BIP) consisted of the ... performed at 65°C for 30 and 60 min, and compared with the results of the standard PCR assay There was no difference between the detection limit of the LAMP reaction and the PCR reaction at 60 ... (23nt), a TTTT linker and the antisense sequence of B2 (23nt): 5'- CC GATGGAGTGAAACTGGAACTG-TTTT-CGTCATGCTCTCCGAGGCCAGCG-3' The outer primers were F3 (19nt): 5'- GAGGAAGCGCAAAAAGAAC-3', and B3...
- 8
- 307
- 0
báo cáo hóa học:" An inexpensive and rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification" docx
Ngày tải lên :
20/06/2014, 04:20
... comprised the antisense sequence of F1 (23nt), a TTTT linker and a sense sequence of F2 (23nt): 5'CAACAATGCTTCTTGTGATTACA-TTTT-GAACCCG AGGGGACTGCTCGCTT-3' Backward inner primer (BIP) consisted of the ... performed at 65°C for 30 and 60 min, and compared with the results of the standard PCR assay There was no difference between the detection limit of the LAMP reaction and the PCR reaction at 60 ... (23nt), a TTTT linker and the antisense sequence of B2 (23nt): 5'- CC GATGGAGTGAAACTGGAACTG-TTTT-CGTCATGCTCTCCGAGGCCAGCG-3' The outer primers were F3 (19nt): 5'- GAGGAAGCGCAAAAAGAAC-3', and B3...
- 8
- 425
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
Ngày tải lên :
07/03/2014, 16:20
... products The harmonization of test methods cannot be immediate, and for certain groups of products International Standards and/ or national standards may already exist that not comply with this ... drafted in accordance with the rules given in the ISO/IEC Directives, Part The main task of technical committees is to prepare International Standards Draft International Standards adopted by the ... (9.4.1 and 9.4.2) so that the bottom is uppermost, and place them in the incubator (6.3) set at 37 °C for the first plating-out medium (5.2.4.1) The manufacturer's instructions shall be followed for...
- 34
- 690
- 0
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx
Ngày tải lên :
16/03/2014, 02:20
... 5¢AACTTCCAAAAGGAAGCATTT-3¢, and that of the antisense strand is 5¢-ATGCTTCCTTTTGGAAGTTTT-3¢ Specific anti-TMV dsRNA (284 bp) was obtained by T3 and T7 in vitro transcription (MEGAscript T3 High ... antisense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; antisense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG TCTC-3¢) ... Transcription Kit, MEGAscript T7 High Yield Transcription Kit; Ambion) and hybridization of the obtained RNA strands The templates for the T3 and T7 transcriptions were prepared by RT-PCR with...
- 9
- 448
- 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
Ngày tải lên :
28/03/2014, 09:20
... issues, and to discuss best practices According to a 2004 study, this training was an important opportunity for mission staff to regularly interact with one another and network with headquarters staff.52 ... mission Technical Assistance • The bureau managed a program for anemia reduction and vitamin A supplementation in the states of Uttar Pradesh and Jharkhand • The bureau assisted Indian state governments ... not require missions and bureaus to report their obligations and expenditures for the CS/MH account, it could not provide these data at our request and is limited in its ability to verify that...
- 64
- 379
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
Ngày tải lên :
21/06/2014, 01:20
... 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific ... participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The authors declare that ... into the hybridization mixtures and incubated at 37°C for 10 and enriched in the bottom of the tube with a NdFeB magnet A 20-μL supernatant was taken to measure relative fluorescence intensity...
- 9
- 469
- 0
báo cáo hóa học: " An improved spectral homotopy analysis method for solving boundary layer problems" potx
Ngày tải lên :
21/06/2014, 02:20
... results GTM and PS conceived of the study and formulated the problem SS participated in the analysis of the results and manuscript coordination All authors typed, read and approved the final manuscript ... converges to the numerical result at orders [3,1] and [2,2] Moreover, Table shows that the ISHAM solution converges to the accurate solution of Howarth and the bvp4c result faster than the original ... For the MHD boundary layer problem, Tables and illustrate the exact and approximate values of f’ (h) and f“ (0) at different values of h and the magnetic parameter M, respectively The absolute...
- 9
- 377
- 0
Báo cáo hóa học: " Research Article A Cascade of Boosted Generative and Discriminative Classifiers for Vehicle Detection" pptx
Ngày tải lên :
21/06/2014, 22:20
... Cascade detector In this section, we discuss the implementation of the attentional cascade [2] This architecture had shown to be an appropriate method for fast and reliable object detection EURASIP ... some features from this set not contain any useful information (noise) In literature, different methods have been used for the selection of useful and representative features: statistical methods ... j (x), m j ) is the Bhattacharya distance between the histogram h j and model histogram m j , and θ j is the optimal threshold on the distance for this feature Bhattacharya distance is defined...
- 12
- 403
- 1
Báo cáo hóa học: " Research Article An Adaptively Accelerated Lucy-Richardson Method for Image Deblurring" pptx
Ngày tải lên :
22/06/2014, 00:20
... clear that the performance of the proposed AALR method is consistently better than the LR method In Figures 5(a), and 5(b), it can be seen that the exponent q has value near three at the start of ... performs better in terms of SNR improvement, consumed iterations, and computation time than the other iterative methods The SNR achieved in AALR method is less than ForWaRD and RI (≈ dB) This ... iterations and is approaching to one as iterations increase Thus, AALR method prefers speed at initial stage of iterations and stability at later stages It can be observed in Figures and that...
- 10
- 230
- 0
Báo cáo hóa học: " Research Article An Efficient Kernel Optimization Method for Radar High-Resolution Range Profile Recognition" docx
Ngày tải lên :
22/06/2014, 20:20
... different, the maximum elevation difference between the test data and training data is about degrees The 2nd and the 5th segments of Yark-42, the 5th and the 6th segments of An- 26, the 6th and the 7th ... the UCI benchmark repository [12] Except Pima data with training and test sets, in order to evaluate the true performance, other data are randomly partitioned into two equal and disjoint parts ... into several segments, the training data and test data are chosen from different data segments, respectively, which means, the target orientations corresponding to the test data and training data...
- 10
- 359
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
Ngày tải lên :
10/08/2014, 21:23
... AS-PCR with nested primers P2 (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR ... type and V617F mutation JAK2 were amplified with primers P1 (5’- GATCTCCATATTCCAGGCTTACACA) and P1r (5’- TATTGTTT GGGCATTGTAACCTTCT) and then cloned into the pBluescript KS vector (Stratagene) ... primers to discriminate wild type and mutant alleles It has a reported sensitivity of 0.1% to 1% mutant allele for detection of JAK2V617F [19,21,26] Another commonly used JAK2V617F detection method...
- 7
- 435
- 0
Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf
Ngày tải lên :
12/08/2014, 01:22
... Rani Hospital and Moti Lal Nehru Medical College staff and also highly thankful to the patients and their relatives for their participation in the present study Written consent was obtained for ... histopathologically and to find out the final diagnosis of the oral lesions This approach acceptable to find out the positivity rate between HPV detection and oral lesions We did not detect any ... of the HR-HPV in these lesions Materials and methods Clinical data collection and sample collection Four hundred and thirty patients of the OSMF and OSCC cases were taken from the Department of...
- 10
- 453
- 0
báo cáo khoa học: " A simple and high-sensitivity method for analysis of ubiquitination and polyubiquitination based on wheat cell-free protein synthesis" potx
Ngày tải lên :
12/08/2014, 03:20
... target protein Since E3 binds to both E2 and the target protein, and acts as scaffold between E2 and the substrate protein, the E3 ligase is the major determinant for selecting target proteins for ... recombinant protein of HECT-type E3 ligases without truncation and detected their ubiquitin-conjugation and polyubiquitination activity by luminescent analysis (Fig 2C and 2D) The ubiquitin-conjugation ... out with purified (A and B) or crude recombinant CIP8 (C and D) and detected by luminescent analysis with anti-FLAG antibody (A and C) and immunoblot analysis (B and D) His-Ub or Mix-Ub indicate...
- 11
- 349
- 0
Báo cáo y học: " An efficient in vitro-inoculation method for Tomato yellow leaf curl virus" ppsx
Ngày tải lên :
12/08/2014, 04:20
... evaluate the performance of transgenic plants and it is suitable for testing such plants under controlled environment and thus meeting the regulations for testing transgenic plants In addition, the ... The method was used successfully to inoculate susceptible tomato plants with TYLCV and to test for TYLCV resistance in wild tomato plants Methods Cloning of a TYLCV genome Leaves from a tomato ... difficult to perform using natural or whitefly-inoculation methods Furthermore, the method is suitable for testing the specificity of interaction between different tomato genotypes and TYLCV strains...
- 9
- 291
- 0
Báo cáo khoa học: " Comparisons of Sampling Procedures and Time of Sampling for the Detection of Salmonella in Danish Infected Chicken Flocks Raised in Floor Systems" pptx
Ngày tải lên :
12/08/2014, 15:20
... agreement P+ and P- are important descriptive statistics P0 is the proportion of samples for which the sample types agree (it does not distinguish between positive and negative agreement) P+ and ... prior to slaughter Acknowledgements The Salmonella laboratory technicians and Jens Christian Jørgensen at the Danish Veterinary Institute in Aarhus, the District Veterinary Officers and the poultry ... proportion of chance agreement is calculated and corrected for, this would only be appropriate and relevant under the conditions of statistical independence – which is clearly not the case Landis...
- 10
- 276
- 0
Báo cáo y học: " ngLOC: an n-gram-based Bayesian method for estimating the subcellular proteomes of eukaryote" pps
Ngày tải lên :
14/08/2014, 07:21
... existing methods Comparisons were made in three ways: by using the ngLOC dataset to train and test other methods; by testing ngLOC on another dataset; and by training and testing ngLOC on another ... data that must be analyzed Hence, computational methods that can accurately and efficiently elucidate these proteins with respect to their functional annotation, including subcellular localization, ... able to identify outdated annotations in the PLOC dataset, identify potential multi-localized proteins in data not annotated accordingly, and consider alternate localizations beside the predicted...
- 17
- 258
- 0
Integrated analysis of audiovisual signals and external information sources for event detection in team sports video
Ngày tải lên :
12/09/2015, 08:19
... exploit the fact that segments are more cohesive within themselves than when they transit to another segment This has been reflected in text segmentation and video shot segmentation works In text, topic ... motion vectors, and zooms from opposite motion vectors at the two ends of macroblock columns To estimate quantitatively camera’s rotational, zooming, and/ or translational motion, a transformation ... soccer and 0.77 ∼ 0.95 for tennis Note that this group of methods still fail to detect events that not have distinctive audiovisual patterns, e.g substitution in soccer Decision tree-based method...
- 164
- 397
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
Ngày tải lên :
08/03/2014, 08:20
... by competition with wild-type and synthetic mutant D-TERM DNA and mt-TERM DNAs The sequences of the normal and mutant versions of the promoter distal putative transcription terminator D-TERM, as ... 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination site will be referred to as promoter distal transcription termination ... Location of the putative D-TERM element for H-strand transcription termination on the mouse mt genome (A) Location of the D-TERM element on the mouse mt genome The triangles represent the tRNA...
- 13
- 415
- 0