declare a copy constructor and an assignment operator for classes with dynamically allocated memory
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... housed at BIOQUAL, Inc Rockville, MD, according to standards and guidelines as set forth in the Animal Welfare Act and The Guide for the Care and Use of Page 14 of 19 Laboratory Animals, as well as ... pre- and post-raltegravir viral load measurements was done Viral load values at Day 0, Day and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start Significant differences...
- 19
- 317
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... introduced before, which are made of ceramic material, another device mainly made of wet textile band has been designed, manufactured and characterised It is basically a cotton band of 25 cm width and ... first rigorous analysis of the direct and indirect evaporative systems, considering both the advantages and disadvantages and indicating and establishing some basis about their design, was developed ... water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation...
- 28
- 652
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot
... Sakai oligoDNA microarray and the whole genome PCR scanning DNA Res 13, 3–14 Ogura Y, Ooka T, Asadulghani, Terajima J, Nougayrede JP, Kurokawa K, Tashiro K, Tobe T, Nakayama K, Kuhara S et al ... Escherichia coli and Shigella strains Infect Immun 63, 4721–4728 Abe H, Miyahara A, Oshima T, Tashiro K, Ogura Y, Kuhara S, Ogasawara N, Hayashi T & Tobe T (2008) Global regulation by horizontally transferred ... formation, and lipid raftassociated protein Annexin A2 also accumulates at the adherent site The interaction of EspL2 with Annexin A2 induces the condensation of F-actin, leading to the formation...
- 6
- 272
- 0
Báo cáo y học: "A functional difficulty and functional pain instrument for hip and knee osteoarthritis" ppsx
... calibrations for hip and knee patients and for males and females and incorporate them into future CAT applications This is an approach that we consider interesting for potential future research ... item bank, and the WOMAC Results The average age of the study sample was 61.8 years (standard deviation 15.1), and 64.5% of participants were female (Table 1) The majority of patients had OA affecting ... Subjects with knee OA had more difficulty than those with hip OA with items that involved stairs and squatting and kneeling Those with both hip and knee OA had more difficulty with rolling and moving...
- 12
- 360
- 0
Báo cáo y học: " Planning and problem-solving training for patients with schizophrenia: a randomized controlled trial" doc
... verbal memory maintenance and manipulation [42] The Corsi Block-Tapping Task was used to assess spatial working memory maintenance and manipulation, analogous to digit span forward and backward ... study and wrote the protocol DH and JF developed the Plan -a- Day training and diagnostic versions KR and MR collected the data KR, DH and MB undertook the statistical analyses and prepared them for ... participants are given a set of errands for one day that are described by location, time, action and importance Participants have to interactively construct a plan for this set of errands, taking...
- 11
- 438
- 0
Báo cáo y học: " Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities" docx
... performed (maxima, minima, averages and standard deviation) for each of the variables In all cases the significance level used was 5% Crossed variables and bilaterally correlated analysis were also ... Miral s/n, 50009 Zaragoza, Spain Correspondence: Departamento de Psicolog a y Sociolog a Universidad de Zaragoza San Juan Bosco, 50009 Zaragoza (Espa a) E-mail: salavera@unizar.es ABSTRACT: Background: ... (Universidad de Zaragoza, Espa a) Departament de Psychology and Sociology Education Faculty, Zaragoza University, C/ San Juan Bosco, 50009 Zaragoza, Spain Physiotherapy Research Unit, Zaragoza University,...
- 20
- 325
- 0
A combined statistical and in silico framework for analysis and characterization of microbial and mammalian metabolic networks
... research Advanced technical expertise from bioinformatics, computation, statistical analysis, and mathematical modeling are all pivotal for integrating and making sense of large and complex datasets ... experimental data obtained from different cell culture experiments Microbial and mammalian metabolism - available genomic and biochemical information for microbial and mammalian metabolic systems, ... important There is also a need for normalizing the data as different scales and units may lead to irrelevant or insignificant results from data analysis Thus data sets are generally scaled to mean...
- 220
- 364
- 0
Báo cáo khoa học: "Minimized models and grammar-informed initialization for supertagging with highly ambiguous lexicons" pdf
... can be used to constrain learning—prior to considering any particular language, grammar or data set Baldridge (2008) uses this observation to create grammar-informed tag transitions for a bitag ... methods for the frequent and highly ambiguous words the and in Basic EM wanders far away from the gold assignments; it has little guidance in the very large search space available to it IP-minimization ... Table gives performance on the CCGbank test sections All models are well above the random baseline, and both of the strategies individually boost performance over basic EM by a large margin For...
- 9
- 420
- 0
báo cáo hóa học: "Infrared thermography as an access pathway for individuals with severe motor impairments" docx
... camera placement This participant had an awkward position in his wheelchair (See Figure 3(b)) which forced us to position the thermal camera at an angle and distance from the participant that was ... Gautherie M: Atlas of breast themogmphy with specific guidelines for eramination and interpretation Milan, Italy, PAPUSA; 1989 Okada Y, Kawamata T, Kawashima A, Hori T: Intraoperative application of ... thermographic data analysis, and drafted the manuscript ANV read the manuscript and 10 11 12 13 14 15 16 17 Tai K, Blain S, Chau T: A review of emerging access technologies for individuals with...
- 8
- 393
- 1
Báo cáo y học: " The MATISSE study: a randomised trial of group art therapy for people with schizophrenia" pdf
... developing the data analysis plan BB, SP, TS and FAO helped refine study methods and contributed to the collection and management of study data All authors read and approved the final manuscript Competing ... about the group and promote engagement Telephone and postal contact with participants and those involved in their care was used to promote engagement and retention in groups Standard care Standard ... referral to an activity group plus standard care, and standard care alone The guidance given to group facilitators on processes and response to adverse events of Art Therapy and activity groups...
- 9
- 344
- 0
On the adaptive and learning control design for systems with repetitiveness
... spatially in states, a state transformation is introduced such that the final state control problems are formulated in the phase plane to facilitate spatial ILC design and analysis Then, a dual-loop ... periodic parameters, such as plants with unknown control directions, plants in parametric-strict-feedback form, plants that are nonlinear in parameters, etc Another major advantage of the new adaptive ... time and the non-vanishing adaptation fully characterizes this type of operation (sometimes called also continuous adaptation) Extracting the constant feature and the time-varying feature of parameters...
- 271
- 265
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine ... TGA with a platinum pan A nitrogen atmosphere was used for each trial Some analyses were performed on a Perkin Elmer-7 TGA with an aluminum pan A nitrogen atmosphere was also used for these trials ... Figure DSC of atypical anhydrous Form I (sample 11) amorphous material and/ or an impurity Note that both of these samples also have atypical preparations (see Table 1) Additional analyses would be...
- 16
- 549
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and 10 nucleotides (AGCCA17aGGAC20aA), respectively The P horikoshii tRNAArgCCU gene (5¢-GGACCGGTAG CCTAGCCA17aGGAC20aAGGGCGGCGGCCTCCTAAG CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG ... Konno et al However, it was reported that, in the aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins ... S14–H14 turn is almost conserved, as Gly ⁄ Ala-Xaa-Asp ⁄ Glu-Xaa (Xaa stands for any amino acid) and NH and C@O of the main chain of the residue corresponding to Val418 in the S16 strand are directed...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... hydroxyurea, caffeine and ethyl methanesulphonate Implications for roles of RNases H in DNA replication and repair Genes Cells 5, 789–802 Rumbaugh JA, Murante RS, Shi S & Bambara RA (1997) Creation and ... here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials The ... dimethylbenzimidazole, 200 lm PIPES as an internal standard, and lg of protein samples in a final volume of 100 lL The reaction mixture was incubated for 10 at 37 °C and transferred to 400 lL cold methanol...
- 10
- 561
- 1
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 16864 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a 1.5% (w/v) agarose...
- 12
- 507
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
... organic and conventional farms located in alpine, upland and lowland regions Notably, and rather innovatively, the authors included an estimate for GHG impacts of the estimated land use change ... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency ... organic and one conventional arable farm on clay soil (both growing potato, sugar beet, wheat, carrot, onion and pea) and one organic and conventional vegetable farm on sandy soil (leek, bean,...
- 41
- 524
- 1
Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot
... to be at work A man I walked in Another man~ walked ont Hez was angry (15) A man walked in John saw the man Example (15) has a natural reading where the definite description is anaphorically linked ... metamodule Evaluation and an object program Logic Database, and the meta-program manipulates the object program We translate first order conditions into G6del goals, and then apply the goal to the ... to an antecedent We propose to make such implicit anaphoric links explicit, as in (16) In example (4) the noun phrase another man is anaphorically constrained by an antecedent noun phrase a man...
- 10
- 365
- 0
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
... Regional organizations and institutions can help facilitate cooperation and coordination and international financial institutions and donors can then play a vital role in seeding and facilitating ... operations and expand their scope of influence substantially Recently established Universal Access Funds and their equivalent, with proper political and organizational mandates, can play an important ... mitigate risks, demonstrate market potential, enhance capacity, and stimulate demand for ICT The support and development of local financial and capital markets, including capacity in new areas...
- 125
- 1,274
- 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino were observed Theoretical approach mathematical simulation ... medium (without H2O2) and incubated further for 120 At the times indicated, the adenylic charge, ATP and inosine were determined as described in Materials and methods H2O2 evokes a decrease and an ... cells and automated assays of adenylate, citrate, pyruvate and glucose-6-phosphate pools Anal Biochem 58, 208216 23 Sillero, M .A. , Del Valle, M., Zaera, E., Michelena, P., Garcia, A. G & Sillero, A...
- 12
- 506
- 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... our measurements), and Aex and Aem are the absorbance of the sample solution at the excitation and the emission wavelengths PrtA activity was measured at or 20 lm Dabcyl– EVYAVES–Edans substrate ... internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area ... insulin chain A (B) Change over time in the chromatographic peak area of cleavage fragments Note that the amount of fragments A1 , A2 and A4 decreases on longer exposure to PrtA cleavage (For details...
- 11
- 424
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25