a molecular model of a segment of the polyethylene chain this segment contains 28 carbon atoms dark but in commercial polyethylene there are more than a thousand carbon atoms per strand
Báo cáo y học: "Molecular model of the outward facing state of the human P-glycoprotein (ABCB1), and comparison to a model of the human MRP5 (ABCC5)" docx
... ABCB8 ABCB7 ABCB6 Sav1866 ABCB4 ABCB1 ABCB5 ABCB11 ABCC12 ABCC11 ABCC5 ABCC7 ABCC4 ABCC3 ABCC1 ABCC2 ABCC6 ABCC9 ABCC8 ABCC10 ABCA7 ABCA1 ABCA4 ABCA2 ABCA3 ABCA13 ABCA12 ABCA10 ABCA9 ABCA6 ABCA5 ABCG4 ... there are five main clusters of ABC efflux transporters: ABCA, ABCB, ABCC, ABCD and ABCG Two main branches are seen, with ABCB, ABCC and ABCD in one branch, and ABCA and ABCG in the other branch ABCB ... from the intracellular side with blue areas indicating positive areas and red areas indicating negative areas TMHs are displayed as green ribbons TMH numbering is indicated in white boxes modeling...
- 13
- 289
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
... aspartate-derived amino-acids pathway and aromatic amino-acids pathway in plant and in microorganisms are such that ux coordination could also be obtained The distribution of the carbon skeleton toward the various ... in the rst, the activating interaction of AdoMet with TS may attenuate the changes in the ux of threonine due to a modication of the level of AdoMet Indeed, upon an increase in the level of AdoMet, ... beneath the graphs abscissa) were set at their values in an illuminated leaf cell chloroplast (Table 2) The dotted lines in the graphs indicate the value of the changing input variable in the...
- 13
- 906
- 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... Splice acceptor Phase of intron acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table ... while intron is of phase II [29] The same phases are found in the corresponding introns of the mouse and human genes The consensus polyadenylation signal AATAAA is located in the 3Â UTR at nucleotide ... 4) are located at conserved sites within the MGP coding sequence (Fig 2) Analysis of the phase of each of the xMGP introns located within the coding region revealed that introns and are of phase...
- 10
- 475
- 0
Báo cáo khoa học: "A COMPUTATIONAL MODEL OF THE SYNTAX-PROSODY INTERFACE IN TOKYO JAPANESE" doc
... phonetically as the domain of downstep; the precise character of major phrases is a point at issue in this paper The diagram is annotated according to the notation of Pierrehumbert (1980) The pitch accent ... is the prosodic word rather than the minor phrase which has the parameter setting, in this case X lex So an upcoming lexical item must initiate a prosodic word, but may or may not initiate a minor ... (1977) The Tone Pattern of Japanese: An Autosegmental Theory of Tonology Kaitakusha, Tokyo Kaplan, Ronald and Joan Bresnan (1982) Lexical Functional Grammar: A Formal System for Grammatical Representation...
- 8
- 484
- 0
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt
... replaced by an alanine (Ala374), forming a more open tunnel; however, electron density in this area of 1Q9H is poor In 1GPI, neither asparagine residues are present and a histidine and an alanine ... Cterminal carbohydrate-binding module linked via a proline/ serine/threonine-rich linker to the catalytic domain [45] There are two predicted N-glycosylation sites in the catalytic domain of 1Q9H ... density maps In addition, no side -chain density was apparent for four residues, which were subsequently modelled as alanine All of these residues are located on the surface of the protein and are...
- 12
- 553
- 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... critical for this interaction In fact, pepstatin-inhibited cardosin A was not able to bind to the C2 domain (Fig 5, lane 3), indicating that conformational changes in the aspartic proteinase can ... blocking the immunodetection of this protein after preincubation of the antibody against recombinant cardosin A with native cardosin A (Fig 2B) A Molecular cloning of C cardunculus L PLDa cDNA and ... recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In vitro interactions between native cardosin B, native cardosin A, recombinant...
- 13
- 455
- 0
a model of the impact of mission statements on firm performance
... representativeness of the findings as they might apply to firms of all sizes The findings and conclusions appear to have validity only insofar as similar largerscale corporations are concerned and this ... less than the variance extracted by either of the individual constructs In other words, values along the diagonal of the correlation matrix in Table IV must be greater than the corresponding values ... this latter view and argue that the clearer managers are about their motives in creating a mission statement ultimately determines its final composition, i.e the ends and means specified in the...
- 17
- 490
- 0
báo cáo khoa học: " A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation" potx
... not part of at least one bootstrap sample We also investigated the stability of the regulations by calculating the fraction of bootstrapped networks that contained each edge in the original network ... non-significant in both cases where the best individual regulator was not part of our regulatory mechanism, meaning that the single best regulator was outperformed by a linear combination of other regulators ... data sets, and then performing module discovery and annotation analysis of each of these Page 13 of 15 Network inference We used a least square regression model to infer regulators of each transcriptional...
- 15
- 386
- 0
Báo cáo y học: " A reaction-diffusion model of the receptor-toxinantibody interaction" pot
... distributed over the whole space But in the case of a low internalization rate (i.e low toxin inflow into a cell) the governing equations of these models are of the same type The paper is organized ... This was the main motivation for our approach to tackle the refined RTA model The aim of this study is to numerically evaluate the protective properties of an antibody against a given toxin in the ... antibody are distributed homogeneously in the extracellular domain Ω The boundary conditions on the outer boundary of the domain are assumed to be the constant concentrations of toxin and antibody and...
- 15
- 180
- 0
Báo cáo y học: "A mathematical model of the euglycemic hyperinsulinemic clamp" ppsx
... mathematical modeling, statistical analysis, drafting of the manuscript; ADG: mathematical modeling, drafting of the manuscript; SP: mathematical modeling; Ferrannini E, Mari A: How to measure insulin ... that insulin-stimulated glucose uptake correlates with the appearance of insulin in lymph fluid, a marker for interstitial insulin, rather than with the appearance of insulin in the circulatory ... forcing) state variables of which the values are known at each time; the state variables and the parameters are defined in tables and The model is diagrammatically represented in Figure Equations...
- 11
- 296
- 0
engle and lange-predicting vnet - a model of the dynamics of market depth
... important to include evidence of the informational concerns at the instant closest to the upcoming forecast period Large spreads are any bid}ask deviation greater than the minimal one eighth Minimal ... presented above are similar in character but not uniformly signi"cant This is unsurprising because the sample period is rather short and there are many obvious sources of noise in VNET that in# ate standard ... in a continuous trading environment, these two dates are dropped from the analysis leaving 61 days of data While it may be interesting in future work to investigate these low-activity days, at...
- 30
- 308
- 0
cheap talk, valuable results- a causal attribution model of the impact of promises and apologies on short-term trust recovery
... accident Another example would include the discovery that the driver of the second car had indeed run into the back of the first, but that this driver had just had a heart attack Again, this driver ... that others can make clear and accurate attributions For example, pushing an individual to the ground to avoid being hit by a speeding car takes on a very different meaning compared to the same ... results in many points of interdependence, such that a trust violation in one area of a relationship will carry over adverse consequences to another area of the relationship So even as a trust violation...
- 195
- 273
- 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA ... mediated by unknown mechanism In plants, there are also outward-rectifying K+ channels The KCO1 in A thaliana shares the conserved P-domain with the TOK1 in yeast They are in the same family of ... transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in DNA manipulation, available genome sequence and commercial mutant libraries In this...
- 109
- 382
- 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt
... mentioning that, especially in higher animals (mammals and also in frogs and fishes), an aspartate (aspartic acid 248 in human 4F2hc; aspartic acid 380 in Fig as both the N-terminal and transmembrane ... lost almost all of the GH13 characteristic sequence–structural features, including domain B as well as functional residues (mainly the catalytic triad) The weak points of this scenario are: (a) the ... both ATG1 and ATG2 (Nematoda), indicating that the hcHAT2 and ATG proteins are orthologues Because hcHAT2 ⁄ ATG 7274 are present only in Arthropoda and Nematoda, they probably came from one hcHAT...
- 14
- 564
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the ... using amino acid sequences of the mouse very long -chain acyl-CoA synthetase (mVLACS), human long -chain acyl-CoA synthetase (hLACS1), mouse mediumchain acyl-CoA synthetase proteins (mSA, mMACS1, ... Comparison of MACS (medium -chain acyl-CoA synthetase) family proteins (A) Predicted amino acid sequences are compared for the rat (r), mouse (m) and human (h) O-MACS Dots indicate identical amino...
- 10
- 393
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... Ultracentrifugation of the lipopolysaccharide gave a pellet and an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet ... was an lipopolysaccharide or a capsular polysaccharide and the fraction was not further investigated The proportion of the minor polysaccharide was indicated by the size of the minor peaks in the ... observed The repeating unit of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that...
- 7
- 463
- 0
An evaluation of the textbook English 11 taught at Phan Dinh Phung Secondary school in Hanoi. A case study = Đánh giá sách giáo khoa tiếng Anh 11 dạy ở trường T
... view of materials evaluation He emphasizes the deeper level of materials evaluation by asking the question why materials are the way they are He claims that materials evaluation plays such an ... English in the areas of four language skills and teaching them the basic features of the language; whether the textbooks are appropriate to the context they are used in: level of students and teachers, ... in foreign language teaching They are not simply the everyday tools of the language teachers; they are an embodiment of the aims and methods of the particular teaching/learning situation Good...
- 65
- 2,919
- 7
A study on the validity of the end-term achievement tests on English grade 12, High Schools in Northern Vietnam = Nghiên cứu tính hiệu lực của các bài kiểm tra
... subject domain Sharing attitudes with the above researchers, Heaton (1998:160) stated that This kind of validity depend on a careful analysis of the language being tested and of the particular course ... tomorrow," Mathew said A Mathew said that he arranged to meet them after lunch the next day B Mathew said that he had arranged to meet them after lunch tomorrow C Mathew said that he had arranged to ... learners have achieved the target language knowledge and language skill Bachman (1990:55) shared this point of view when he stated that the fundamental use of testing in an educational program...
- 43
- 1,511
- 9
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu