... wave propagation paths in the facial skeleton and the intracranial brain presented to studythe association ofthe traumatic brain injury (TBI) with the facial trauma sequences Fractures of facial ... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits ofthe biomechanical parameters General trend of maximum intracranial biomechanical parameters ... that the each ofthe NDT markers consists ofa cluster of several elements in which the elemental average values ofthe strain data are collected (C) The bar chart shows the percentage of material...
... complexity and the ability to validate themodel with data More data are needed on sexual life histories as well as further analysis ofthe sensitivity and robustness ofthemodel assumptions The advantages ... by the rate of new partnership formation, the availability of suitable partners, the rate at which partnerships dissolve, and the gap between partnerships Individuals are available to form a new ... Table Themodel fits better to the male data than the female data, due to the choice of fitting procedure (i.e., themodel was fitted to male behavioural data) In both males and females, the model...
... usually based on established standard values which have been adopted over years The concomitant drawback of these generic models is that they are unable to give accurate analysis results at a patient-specific ... generated consist ofa large quantity of tiny cubic hexahedral elements, or so-called voxels, with their size defined by the spatial resolution ofthe image stack The advantage of this approach ... that the internal nodes ofthe FE mesh are moved at interpolated distances so that the shape ofthe elements remains FEA compliant (a) (b) Fig 4.2 (a) A thin steel plate tacked at points (b) Application...
... at the Disambiguating Region A total of 30 pairs ofa garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison ofthe probability decrease at the disambiguating ... Jurafsky A probabilistic modelof lexical and syntactic access and disambiguation Cognitive Science, 20:137–194, 1996 A E Kim, Bangalore S., and J Trueswell A computational modelofthe grammatical aspects ... and Language,, 47:50–68, 2002 C.D Manning and H Sch¨ tze Foundations of u Statistical Natural Language Processing The MIT Press, Cambridge, Massachusetts, 1999 S Narayanan and D Jurafsky A bayesian...
... to 32 g The animal experiments were performed in compliance with the guidelines ofthe Federation of European Laboratory Animal Science Association (FELASA) and approval was granted by the Institutional ... 4°C Thereafter, the supernatants were aliquoted and stored at -70°C until analysis The concentrations of total protein in the brain extracts were measured by Bradford assay (Bio Rad Laboratories, ... brain: (1) The first part ofthe experimental study was designed to investigate a potential role of TNF-dependent regulation of intracranial IL-18 expression in a standardized modelof CHI, using...
... to the inter-channel distance and the direction of arrival (DOA) angle To solve the problem, a reasonable statistical model for the distribution of IPD error and its Gaussian approximation are ... (RIR) of each channel, and then the delay was determined by finding the direct paths from the two measured RIRs A systematic overview ofthe stat -of- the- art of TDE techniques was summarized in the ... effect The relative performance ofthe TDE was evaluated through a number of trials in a simulated rectangular room (12 × 10 × m ) The microphone array is located at (3,3,2) and the distance from the...
... analysis of data All authors have read and approved the final manuscript Additional material Additional file Table S1 Characteristics ofthe radiation-induced head and neck cancer patients (n ... removed the second cancers (one each of laryngeal cancer and esophageal cancer) which arose near the radiation field from the analysis of radiation-induced cancer according to the criteria that Sakai ... Calcaterra TC, Abemayer E, Fu YS, Parker RG: Postirradiation Sarcoma oftheHead and Neck Cancer 1993, 72(3):887-893 Lagrange JL, Ramaioli A, Chateau MC, Marchal C, Resbeut M, Richaud P, Lagarde...
... salivary gland remnants Epithelial markers are expressed, S-100 protein and EMA are negative Oncocytic variant ofa pituitary adenoma Synaptophysin and chromogranin are expressed a EMA, epithelial ... conceived of, coordinated with other coauthors and drafted and revised the manuscript HH, IC, IBS, SH, HJ, MZ and NK participated by acquisition and analysis of literature data and helped to draft the ... oncocytic variant, granular cell tumour, pituicytoma, oncocytic neoplasm arising from developmental salivary gland remnants and oncocytic variant ofa pituitary adenoma [2-4] Rarely, they should...
... neck There was no localized accumulation of fat in her abdomen and in the submental region of her neck The hump in the back of her neck was causing neck pain, headaches off and on and sleep apnea ... was causing her discomfort and affecting the motion of her neck An ultrasonography scan ofthe cervical region reported a large amount of subcutaneous fat around the posterior aspect ofthe Page ... of antiretroviral therapy including these drugs: on the basis of our data we can formulate the hypothesis ofa pharmacological pathogenesis that underlies the development of this case of Buffalo...
... TAs are paired and usually originate from the anterolateral or lateral aspect ofthe abdominal aorta The TA is a long, thin vessel that arises at an acute angle from the abdominal aorta, at the ... Ozan et al [6] Furthermore, Xue et al found a right TA artery arising from the anterior surface ofthe abdominal aorta at the level ofthe left renal artery [14] The first attempt at classification ... artery and a superior suprarenal artery In another case, Onderoglu et al reported the case ofa high origin ofthe right TA located at the level ofthe right renal artery lineage [4] It branched off...
... Blumenthal JA, Babyak MA, Doraiswamy PM, Watkins L, Hoffman BM, Barbour KA, Herman S, Craighead WE, Brosse AL, Waugh R, Hinderliter A, Sherwood A: Exercise and pharmacotherapy in the treatment of major ... Technology, Japan, and a Gerontology and Health Grant from Gunma Prefecture The authors wish to express their gratitude to the mayors and staff ofthe Village of Komochi and the City of Isesaki for their ... quantitatively represents mental and physical complaints The Japanese-language version ofa 1999 survey questionnaire used as part ofthe Alameda County Study [19] was used for the second-wave...
... preparation ofthe manuscript All authors read and approved the final manuscript Written informed consent was obtained from the patient for publication of this case report and accompanying images ... have adapted a modification of Stimson's original method to reduce a purely lateral elbow dislocation Such an atraumatic and mechanically simple technique can prove very useful in a busy casualty ... olecranon in a purely medial direction requires both hands from the main operator, with the assistant constantly applying counter-traction The ease of reduction justifies the use of an additional...
... http://www biomath.info/ The coefficient of variance was calculated as the ratio ofthe standard deviation and the mean of each data set or CV = standard deviation/mean Sacrifice and Data Collection ... significant advantage over standard therapeutic agents in that it addresses the fundamental cause of asthma rather than modifying downstream mediators In addition allergen desensitization has the advantage ... for human asthmatics in that it addresses the primary cause of allergic asthma exacerbations rather than simply blunting the symptoms In addition oral tolerization offers significant advantages...
... (Parameswaran 2004) The large number of commercially available repair materials with a wide variation in the mechanical properties makes the proper selection ofa suitable patch repair material a ... and Al-Hasan 1997) If the repair material is a mortar then ASTM C 109 standard practice was used For deeper repair, coarse aggregate was used with the repair material and ASTM C 39 standard practice ... repair material The repair material was cast against a thin steel plate on the bottom The plate had a layer of epoxy and was impregnated with a sand grit applied to improve bond to the repair material...
... Table of contents List of tables and charts Abstract PART A: INTRODUCTION Rationale ofthestudy Aims ofthestudy Research questions Significance ofthestudy Scope ofthestudy Method ofthe ... presents the rationale, the aims, and the research questions, the significance of study, the scope ofthe study, the method ofthestudy and the design ofthestudy Part B: DEVELOPMENT, consists ofthe ... National University of Education when they are engaged in reading lessons The results ofthe findings can be of great use for the teachers ofthe classes surveyed in the way that they can adapt their...
... daata In Fig 17, it can be noted n that thee curve of thhe analyticaal results liess almost alw ways among the experimenntal results ofthe two hallves ofthe bbeam Fig.17 Deflected shappe at ... NUMERICAL EXAMPLES The numerical solutions ofthe proposed model are compared against experimental data obtained by earlier experimental study In the fact that, a group of two CB which material limited ... partiaal interactionn, based on kinematic assumptions a s substantiallly similar to o the analytiical solution was w reportedd by Schnaabl et al ((2007) Thee nonlinear behaviour of materiall is...
... our case, the lack ofa previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... the cerebral hemispheres AC result from accumulation of CSF surrounded by an arachnoid membrane Vernooij et al 15 found that AC has a prevalence of approximately 1% in the normal population There ... temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important...
... monitor the acetylation status ofthe MMTV promoter subjected to TSA treatment, we used a chromatin immunoprecipitation assay (ChIP) and evaluated the acetylation status ofthe so-called B- and nucleosome ... nucleosome B area) become deacetylated whereas the acetylation of both H3 and H4 of nuclesome F was increased [42] Addition of TSA resulted in only an insignificant increase ofthe acetylation level of ... may change the bulk acetylation pattern of histones, and in this way alter the structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition...
... Butikofer and Valerie Verne for the ELISA assays We thank Pr Roland Douce and Dr Michel Matringe and Mickaela Homan for critical reading ofthe manuscript Special ă thanks to Maighread Gallagher ... Systems Modelling Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway ... initial concentration of cysteine minus the concentration of NAD+ at time, t A small error is made in this calculation as a consequence ofthe time delay in the enzymatic chain Subtraction of the...
... gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene) BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2 Activity values are given as mean values ± standard ... usingthe following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd ... pair of primers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1...