a magnifying glass to probe nuclear structure
up close exploring nature with a magnifying glass
... ALL WRAPPED UP etallic A chrysalis has a m attached to a sheen and will be e points A twig at one or mor and papery It cocoon looks dry a leaf or may be wrapped in all along its attached to a ... comes into contact with the pistil, seeds are produced predator: An animal that hunts and eats other animals prey: Animals that are eaten by other animals or plants pupa: The last stage of an insect ... small creatures, a meadow is more like a towering forest To a beetle, Queen Anne’s lace is as tall as a tree and drops of rain can be a deadly disaster On the other hand, a blade of grass can provide...
- 49
- 175
- 0
A SIRNA SCREEN TO PROBE FOR HYDROXYLASES THAT CAN MODULATE THE REPLICATION OF DENGUE VIRUS
... Abbreviations ABBREVIATIONS ADE antibody dependent enhancement AGO Argonaute ARNT aryl hydrocarbon receptor nuclear translocator Asn asparagine ASPH aspartate beta-hydroxylase BHK baby hamster kidney BSA ... variation), dynamic range → ∞ An ideal assay > Z ≥ 0.5 Large separation band An excellent assay 0.5 > Z > Small separation band A double assay No separation band sample and control bands touch A “yes/no” ... not only can the Z-factor can be used as a tool for comparison and evaluation of the robustness of the HTS assay, it can also be used as a tool to optimize and validate the HTS assay (Table 1.1)...
- 153
- 177
- 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... chorismate mutase by combinatorial mutagenesis and selection: the importance of electrostatic catalysis Proc Natl Acad Sci USA 93, 5043–5048 11 Haslam, E (1993) Shikimic Acid: Metabolism and Metabolites ... changing the overall reaction [50] A rationally designed variant of L-Ala-D/L-Glu epimerase (a third member of the enolase superfamily, Fig 8), containing a mutation (D297G) analogous to that of the...
- 8
- 635
- 0
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... Y and Maeda E 2003 Hierarchical Directed Acyclic Graph Kernel: Methods for Structured Natural Language Data ACL-2003 Zelenko D., Aone C and Richardella A 2003 Kernel Methods for Relation Extraction ... 2004 data shows consistent better performance on all setups than the 2003 data although the ACE 2003 data is two times larger than the ACE 2004 data This may be due to two reasons: 1) The ACE 2004 ... POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model Feature-based methods (Kambhatla, 2004; Zhou et al., 2005; Zhao and Grishman, 20052...
- 8
- 467
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection ... diffraction-limited area AFM AFM was performed in contact mode with a Molecular Force Probe 3D (MFP-3D; Asylum Research, Santa Barbara, CA, USA) using a microcantilever OMCL TR-400 PSA (Olympus, Tokyo, Japan) To...
- 12
- 454
- 0
Báo cáo khoa học: "From Chunks to Function-Argument Structure: A Similarity-Based Approach" doc
... speech data The fragmentary and partially illformed nature of such spoken data makes them harder to analyze than written data such as the Penn treebank typically used as gold standard It should also ... classical PARSEVAL measures to a partial pars- language German English parameter true positives false positives unattached constituents unmatched constituents true positives false positives unattached ... treebank uses a total of 13 functional labels, while the German treebank has a richer set of 36 function labels The evaluation consisted of a ten-fold crossvalidation test, where the training data...
- 8
- 308
- 0
Fundamentals in nuclear physics from nuclear structure to cosmology basdevant, rich, spiro
... fusion facility (Lawrence Livermore National Laboratory, USA) Inside the combustion chamber at the Nova laser fusion facility (Lawrence Livermore National Laboratory, USA) The Euratom Joint Research ... unthinkable that a scientific curriculum bypass nuclear physics It remains an active field of fundamental research, as heavy ion accelerators of Berkeley, Caen, Darmstadt and Dubna continue to produce ... non-spherical so that the rotational levels are analogous to those of diatomic molecules Many nuclei also possess excited rotation bands due to a metastable deformed configuration that has rotational...
- 515
- 336
- 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... Monografia Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t) ... faasikäyttäytymiseen Kitosaanin ja selluloosan välinen spesifinen vuorovaikutus havaittiin, kun kitosaani adsorboitui pysyvästi selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin ... lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin läsnä ollessa, mutta myös kovalenttinen sitoutuminen on todennäköisesti...
- 89
- 701
- 1
capital structure and firm performance a new approach to testing agency theory and an application to the banking industry
... institutional holdings Our application to data from the banking industry is advantageous because of the abundance of quality data available on firms in this industry In particular, we have detailed financial ... vector p; three fixed netputs z (off-balance-sheet activity, physical capital, financial equity capital); and an environmental variable STNPL (the ratio of total nonperforming loans to total loans ... empirical literature that may help explain why prior empirical results have been mixed Our application to the banking industry is advantageous because of the detailed data available on a large...
- 38
- 561
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 2 pptx
... substance that can act as an electron pair acceptor, and a L ewis base is any substance that can act as an electron pair donor In many enzymatic reactions, protons are transferred from one chemical ... Potential energy diagram for the van der Waals attraction between two helium atoms [Data adapted from Gray (1973) and fit to Equation 2.14.] by a critical distance known as the van der Waals contact ... the atom Table 2.4 provides the van der Waals radii for the most abundant atoms found in proteins Imagine drawing a sphere around each atom with a radius defined by the van der Waals contact radius...
- 41
- 372
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 3 pot
... ligand at the initiation of the experiment) The chambers are then sealed, and the apparatus is place on an orbital rocker, or a mechanical rotator, in a thermostated container (e.g., an incubator ... nonequivalent ligand binding sites The data and fit to Equation 4.27 are the same as for Figure 4.5 in all fields put a great deal of emphasis on finding mathematical transformations of data that would ... wishes to compare the affinities of a number of ligands for a particular receptor For example, given a natural ligand for a receptor (e.g., a substrate for an enzyme), one may wish to design nonnatural...
- 41
- 418
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 4 ppsx
... noncovalently associated as a multiprotein complex This supercomplex, referred to as CAD, comprises the enzymes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase Because the active ... common to perform initial experiments with a limited number of data points that span as broad a range of substrate concentrations as possible (at least a 100-fold substrate concentration range) to ... diffusion barrier to rapid catalysis 5.6 EXPERIMENTAL MEASUREMENT OF kcat AND Km 5.6.1 Graphical Determinations from Untransformed Data The kinetic constants V and K are determined graphically with...
- 41
- 521
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 5 docx
... TRANSITION STATE STABILIZATION 165 Table 6.2 Some examples of electrophilic catalysis in enzymatic reactions Enzyme Acetoacetate decarboxylase Aldolase Aspartate aminotransferase Carbonic anhydrase ... by acting as Brønsted—Lowry acids and bases in what is referred to as general acid and general base catalysis For catalysis by small molecules (nonenzymatic reactions), general acid/ base catalysis ... of reaction for (A) a general base-catalyzed reaction and (B) a general acid-catalyzed reaction itself Identification of the group(s) participating in general acid/base catalysis in enzymes has...
- 41
- 404
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 6 pot
... noise and having a reasonable signal to Figure 7.10 Deviation from Beer’s law Over a small concentration range, the absorption at some analytical wavelength tracks linearly with analyte concentration, ... of as little as 0.001) and can greatly increase productivity by allowing up to 96 samples to be assayed simultaneously Most plate readers are based on optical filters rather than monochromators, ... recommended names, alternative names, catalytic activities, information on cofactor utilization, and associated diseases for a very large collection of enzymes A complete description of the data bank and...
- 41
- 458
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 7 pdf
... commonly used alternative methods are available to quantify peaks from strip-chart recordings The first is to measure the peak height rather than integrated area as a measure of analyte mass This is ... changes in enzyme activity that accompany changes in temperature can be mechanistically informative Recall from Chapter that the rate of a reaction can be related to the activation energy for attaining ... Protein Analysis: A Practical Guide to L aboratory Protocols, Chapman & Hall, New York Copeland, R A. , Williams, J M., Giannaras, J., Nurnberg, S., Covington, M., Pinto, D., Pick, S., and Trzaskos,...
- 41
- 326
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 8 docx
... example, one may wish to screen several thousand compounds as potential inhibitors to find those that have some potency against a particular target enzyme These compounds are likely to span a ... quantitative structure activity relationships (QSAR) was first championed by Hansch and his coworkers (Hansch, 1969; Hansch and Leo, 1979) In a typical QSAR study, a series of analogues of a lead ... known structures of the substrate or product of a particular enzymatic reaction With a lead compound in hand, analysts subject the substance to small structural perturbations and test these analogues...
- 41
- 320
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 9 ppt
... 2695 Cha, S., Agarwal, R P., and Parks, R E., Jr (1975) Biochem Pharmacol 24, 2187 Copeland, R A (1994) Methods of Protein Analysis, A Practical Guide to L aboratory Protocols, Chapman & Hall, ... trapped in a form that can no longer support catalysis Because they are chemically altered via the mechanism of enzymatic catalysis at the active site, mechanism-based inhibitors always act as competitive ... carbon of the substrate and an active site serine residue as the attacking nucleophile Several groups have taken advantage of the ability of boron to adopt a tetrahedral ligand sphere in preparing...
- 41
- 414
- 0
A Practical Introduction to Structure, Mechanism, and Data Analysis - Part 10 doc
... inhibitor of threonine deaminase Another classic example of feedback inhibition comes from aspartate carbamoyltransferase This enzyme catalyzes the formation of carbamoylaspartate from aspartate and ... kinetic data Reference: F W Perrella, Anal Biochem 174, 437 (1988) Graphfit A commercial package for data management and graphic display of enzyme kinetic data and other scientific data graphing ... Protein Analysis: A Practical Guide to L aboratory Protocols, Chapman & Hall, New York, pp 151—160 Copeland, R A. , Williams, J M., Giannaras, J., Nurnberg, S., Covington, M., Pinto, D., Pick, S., and...
- 41
- 405
- 0
A simple introduction to working with LVM
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... be able to see it included in the output of vgscan: root@lappy:~# vgscan Reading all physical volumes This may take a while Found volume group "skx-vol" using metadata type lvm2 Now that we have...
- 7
- 674
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25