0

a luteotropin hormone releasing hormone analog

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Báo cáo khoa học

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage ... and acetylated H3 (Upstate Biotechnology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam) Analysis ... mRNA and DNA, TSA addition [ÔearlyÕ (E) or ÔlateÕ (L)] and hormone induction RNA and DNA were extracted from pools of eight oocytes each (C) Representative denaturing acrylamide gel showing analysis...
  • 10
  • 500
  • 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học

... amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ for 4-1BB, 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and ... 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ In order to overexpress 4-1BB and TRAF1 in the HeLaTR cells, the entire coding regions of the 4-1BB and ... 5¢-CCCGGGATATCTAAGTGCTGG TCTCCACAATGCACT-3¢ for TRAF1 precipitated by isopropyl alcohol Single-stranded cDNA was synthesized with lg of the total RNA and was used as the template for RT-PCR Amplification...
  • 10
  • 491
  • 0
Fairness  a dual hormone regulation approach

Fairness a dual hormone regulation approach

Cao đẳng - Đại học

... resultant effect on brain regions The amydgala, a brain region associated with fear processing is activated when the HPA axis is evoked and similarly the frontal cortex, a brain region associated ... MediaLab program The same protocol as Study was followed Similar to Study participants were made to fill out a post-game questionnaire and payment was made according to a random selection of trials ... complete Hormone Assay: All saliva samples were processed and analyzed in the Salivary Biomarkers Research Laboratory in the Department of Epidemiology and Public Health, the National University...
  • 65
  • 34
  • 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Báo cáo khoa học

... GTGAATAAAAATGCGCGGCGATGTCCAG GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC ... CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG ... GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC GCATCTTCTCCGTAGATCGATAATGCTGC CATTATCGATCTGGGGACAAGATGCAAAAGC GCTTTTGCATCTTGTCCCCAGATCGATAATG Forward Reverse Forward Reverse Forward Reverse Forward...
  • 13
  • 311
  • 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

Báo cáo khoa học

... al Reaction of a- synuclein with dopamine analogs Fig Spectrophotometric characterization of the reactions of DA analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, ... lM) was incubated with 200 lM of HQ (middle) or DA (right) for days The a- Syn alone sample was as a control (left) All graphs are topographical height images of lm2 in area and the scale bar represents ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn...
  • 12
  • 414
  • 0
Báo cáo toán học:

Báo cáo toán học: "Products of all elements in a loop and a framework for non-associative analogues of the Hall-Paige conjecture" potx

Báo cáo khoa học

... appears as a row, y as a column, and z as an entry A k-plex is a subset of L in which each symbol appears as a row, column, and entry precisely k times A 1-plex is called a transversal and a k-plex ... then a1 (a2 (· · · (ak ) · · · ) ∈ A( Q) Proof Set A := A( Q) (i) Let ρ = La1 · · · Lak Then A (qA) = a1 (a2 · · · (ak q) · · · )A Since Q /A is a group, we may reassociate to get A (qA) = a1 (a2 ... the translation notation feels cumbersome, the idea is very basic Given the product a1 (a2 (· · · (ak x) · · · ) = x, we may reduce both sides mod A to get a1 Aa2 A · · · ak AxA = xA a1 Aa2 A ·...
  • 15
  • 298
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Báo cáo khoa học

... set, A5 1 (5¢GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG ... amplified as described above using partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and ... 32281–32287 31 Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A. , Borkowski, J., Ihara, M & Ohta, M (1998) Cloning and characterization of a new subtype of thyrotropin -releasing hormone receptors...
  • 11
  • 506
  • 0
Báo cáo khoa học: Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview docx

Báo cáo khoa học: Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview docx

Báo cáo khoa học

... Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, Tahara M, Hisamoto K, Kurachi H & Murata Y (2000) Activation of the luteinizing hormone beta promoter by gonadotropin -releasing hormone requires ... A, Ohmichi M, Kurachi H, Ikegami H, Hayakawa J, Tasaka K, Kanda Y, Nishio Y, Jikihara H, Matsuura N et al (1999) Role of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase ... disease and poor prognosis The fact that a high proportion of advanced-stage (stages III and IV) ovarian carcinomas express GnRH receptor mRNA and protein, as compared to early-stage carcinomas...
  • 16
  • 311
  • 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Báo cáo khoa học

... Materials and methods TRH-degrading Lectin Brain enzyme Serum enzyme Liver enzyme SNA (Sambucus nigra A. ) GNA (Galanthus nivalis A. ) MAA (Maackia amurensis A. ) DSA (Datura stramonium A. ) ConA (Concanavalin ... Sprague– Dawley rats were maintained at our institute according to the animal welfare committee of the Medizinische Hochschule Hannover, Germany All animals had access to standard chow and water ... interpretation However, a rapid decrease in the enzymatic activity was already observed within a few days after thioacetamide treatment As liver cirrhosis is generally a long-term process and is...
  • 9
  • 477
  • 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Báo cáo khoa học

... by bis-ANS was decreased upon phosphorylation A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases the accessible ... The Authors Journal compilation ª 2009 FEBS C Krintel et al product obtained using the sense primer 5¢-ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ... Multiscan 791 CCD camera (Gatan UK, Abingdon, UK) [23] Acknowledgements We would like to thank B Danielsson and M Baum´ garten for excellent technical assistance, and R Wallen and E Hallberg (Cell and...
  • 11
  • 562
  • 0
Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

Báo cáo khoa học

... against the input DNA Stable knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA ... binding partners, a human fetal liver cDNA library was screened in a yeast twohybrid assay using Rev-erbb as bait A screen of approximately 106 yeast transformants revealed that ZNHIT-1 interacted ... amplification of a 230-bp fragment of the apoCIII promoter, with the forward primer (TCTCCTAGGGATTTCCCAACTCTCC) and the reverse primer (CTGCCTCTAGGGATGAACTGAGCAG) Quantitative real-time PCR was...
  • 12
  • 423
  • 0
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Báo cáo khoa học

... using a monoclonal antibody directed against the extracellular domain of the TSH receptor (NCL-TSH-R2, Novocastra Laboratories Ltd, Newcastle, UK) (data not shown), and by FACS analysis using BA8, ... double mutant was similar and was the same according to the binding experiments (Table 2) The FACS analysis also confirmed that the T477I/P639S double mutant was able to reach the membrane surface The ... grants: Ministero dell’Uni` versita e della Ricerca Scientifica (MURST), Programma di Ricerca: Le malattie della tiroide: dalle basi molecolari alla clinica Ministero ` dell’Universita e della...
  • 9
  • 499
  • 0
Báo cáo khoa học: Gonadotropin-releasing hormone: regulation of the GnRH gene pot

Báo cáo khoa học: Gonadotropin-releasing hormone: regulation of the GnRH gene pot

Báo cáo khoa học

... vitamin A and its derivative RA in the maintenance of normal reproductive functions was shown more than 70 years ago [126] There are two active metabolites of vitamin A, all-trans-RA (atRA) and ... Isolation and characterization of the human gonadotropinreleasing hormone gene in the hypothalamus and placenta Mol Endocrinol 4, 476–480 27 Whyte DB, Lawson MA, Belsham DD, Eraly SA, Bond CT, Adelman ... hypothalamic start site, was identified later in a human placental tumor cell line (JEG) and a human breast tumor cell line (MDA), using primer extension and RT-PCR assays The placental GnRH cDNAs...
  • 21
  • 369
  • 0
Báo cáo khoa học: Gonadotropin-releasing hormone: GnRH receptor signaling in extrapituitary tissues docx

Báo cáo khoa học: Gonadotropin-releasing hormone: GnRH receptor signaling in extrapituitary tissues docx

Báo cáo khoa học

... Ikegami H, Hayakawa J, Tasaka K, Kanda Y, Nishio Y, Jikihara H, Matsuura N et al (1999) Role of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase cascade in gonadotropin -releasing ... 1247–1262 Imai A, Takagi A, Horibe S, Takagi H & Tamaya T (1998) Fas and Fas ligand system may mediate antiproliferative activity of gonadotropin -releasing hormone receptor in endometrial cancer cells ... Hongo A, Kuramoto H, Nakamura Y, Hasegawa K, Nakamura K, Kodama J & Hiramatsu Y (2003) Antitumor effects of a soluble insulin-like growth factor I receptor in human ovarian cancer cells: advantage...
  • 17
  • 340
  • 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học

... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm MgCl2, ... eyestalk (Es) and thoracic ganglia during the gonad maturation cycle Each lane represents an RNA sample from the eyestalk or the thoracic ganglion of one shrimp The last lane shows the RNA samples ... feriatus: hepatopancreas-specific expression and farnesoic acid stimulation of vitellogenin gene expression Mol Reprod Dev 70, 288–300 Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V, Jasmani...
  • 11
  • 546
  • 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

Báo cáo khoa học

... helical and b-sheet conformation [28] and they exhibited a smaller deviation from a- helical rather than b-strand values (see Fig 2C) Tertiary structure An overall evaluation of NOE, 3JHNHa and Ha ... chain of the human/rat CRH analogue seems to fold to an almost linear tertiary structure with the main features being the high degree of helical character and a small bend along the principal ... atoms (Hd2 and Oe2, respectively) are found at ˚ distances larger than 6.5–7.0 A The above data could probably be indicative for a native-like linear CRH structure and suggest a conformational...
  • 11
  • 515
  • 0
Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học

... from total RNA was performed using a Reverse Transcription System (Thermoscrip RT, Invitrogen) Human GHR was amplified from cDNA with primers ACACTCAAGAATGGACTCAAG and TGTAAATTGG CTCATCTGAG under ... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused by an amino acid substitution J Clin ... KA, Rose SJ, Tauber M, Price DA, Heinrich U, Gilli G, Razzaghy-Azar M, Al-Ashwal A, Crock PA et al (2001) Clinical and endocrine characteristics in atypical and classical growth hormone insensitivity...
  • 13
  • 323
  • 0
Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học

... 5¢-TATGTAGGAGCTACAAGAAACATTGAAGGC-3¢ 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢ 5¢-GCCTGAAGTTTTTGGTTCACAGTGAAATTT-3¢ 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢ 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ ... 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢ 5¢-ACATCATGGTATATTATTCATTTAGCTGACACTTT-3¢ 5¢-ATGGATGAGGAAATCGCTGCCCTGGTC-3¢ 5¢-TTAGAAGCACTTCCTGTGAACGATGGA-3¢ 3835 A novel ... (5¢-CGCGGATCC ATGAGCCGGAGAACAAGCGAAACT-3¢) and antisense (5¢-CGCGGATCCTTATATAGTGAAGCGTATTGGAAG FEBS Journal 272 (2005) 3828–3837 ª 2005 FEBS S Yasuda et al A novel zebrafish cytosolic sulfotransferase...
  • 10
  • 336
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học

... sequence and dimeric structure Agric Biol Chem 55, 73–86 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning ... black and white images An area adjacent to the area of interest (A) and an area from an image lacking a specimen (N) were scanned as the background signals When PTPCs were not visible, the focal ... The axon emanating from the somata (light blue arrowheads and enlarged image shown in E) runs towards the midline of the brain with some arborization (boxed area in A) , contralateral after crossing...
  • 10
  • 437
  • 0
báo cáo hóa học:

báo cáo hóa học:" Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor gene promoter" pptx

Hóa học - Dầu khí

... our data was analyzed using pairwise analysis, mean normalization, and T-test statistical analysis (P < 0.05) In the second, we compared our data to that of Garcia-Ortiz et al [7] Eighteen Affymetrix ... Sunnyvale, CA) Each transfection was carried out in triplicate and experiments were carried out a total of times Data was analyzed with the paired T-test using GraphPad Prism software (GraphPad ... Y, Lazar MA: Differential Gene Regulation by PPARgamma Agonist and Constitutively Active PPARgamma2 Mol Endocrinol 2002, 16:1040-1048 17 Benayoun BA, Auer J, Caburet S, Veitia RA: The post-translational...
  • 12
  • 561
  • 0

Xem thêm