Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription Jiadong Wang1, Yang Li1, Min Zhang1, Zhongle Liu1, Cong Wu1, Hanying Yuan1, Yu-Yang Li1, Xin Zhao2 and Hong Lu1 State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China Department of Animal Science, McGill University, Montreal, Canada Keywords apoCIII; Rev-erbb; transcriptional regulation; zinc finger HIT domain-containing protein 1; ZNHIT-1 Correspondence H Lu, State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Fax: +86 21 65642505 Tel: +86 21 65642505 E-mail: honglu0211@yahoo.com (Received 27 June 2007, revised 15 August 2007, accepted 22 August 2007) doi:10.1111/j.1742-4658.2007.06062.x The orphan receptors, Rev-erba and Rev-erbb, are members of the nuclear receptor superfamily and specifically repress apolipoprotein CIII (apoCIII) gene expression in rats and humans Moreover, Rev-erba null mutant mice have elevated very low density lipoprotein triacylglycerol and apoCIII levels However, ligands for Rev-erb are unknown and the regulatory mechanism of Rev-erb is poorly understood Conceivably, cofactors for Rev-erb may play an important role in the regulation of lipid metabolism In this study, a zinc finger HIT domain-containing protein, ZNHIT-1, interacted with Rev-erbb ZNHIT-1 was found to be a conserved protein in eukaryotes and was highly abundant in human liver Furthermore, ZNHIT-1 was identified as a nuclear protein Serial truncated fragments and substitution mutations established a putative nuclear localization signal at amino acids 38–47 of ZNHIT-1 A putative ligandbinding domain of Rev-erbb and the FxxLL motif of ZNHIT-1 were required for their interaction Finally, ZNHIT-1 was recruited by Reverbb to the apoCIII promoter and removed the Rev-erbb-induced inhibition of apoCIII transcription These findings demonstrate that ZNHIT-1 functions as a cofactor to regulate the activity of Rev-erbb, and may play a role in lipid metabolism The nuclear receptors (NRs) are a family of transcription factors which regulate a wide array of biological processes, including those involved in diabetes, obesity, cardiovascular disease and cancer [1] Many important medicines, including 12 of the top 100 selling drugs, target NRs [2] Generally, NRs regulate the activity of transcription by binding to specific ligands and coregulators [3] However, the regulation of transcriptional activity by orphan nuclear hormone receptors, whose ligands are not identified or are lost during evolution, is less clear The Rev-erb family is a subgroup of orphan receptors, two members of which have been isolated from mammalian genotypes: Rev-erba, also known as Ear-1 or NR1D1 (official nomenclature), and Rev-erbb, also known as RVR, BD73 or NR1D2 (official nomenclature) [4] Rev-erba and Rev-erbb are unique NRs that lack the activation function domain required for Abbreviations ChIP, chromatin immunoprecipitation; Co-IP, coimmunoprecipitation; GFP, green fluorescent protein; GST, glutathione S-transferase; LBD, ligand-binding domain; NCBI, National Center for Biotechnology Information; NLS, nuclear localization signal; NR, nuclear receptor; RFP, red fluorescent protein; SRCAP, SNF-2 related CBP activator protein; VLDL, very low density lipoprotein; ZNHIT-1, zinc finger HIT domaincontaining protein 5370 FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al ligand-dependent activation of transcription by other members of the NR superfamily [5] Therefore, Reverb receptors constitutively behave as unliganded receptors and repress transcription by binding to corepressor molecules [6] Both Rev-erba and Rev-erbb are widely expressed [4] Rev-erb represses transcription of the Rev-erba gene itself [7], as well as N-myc [8], Bmal1 [9], enoyl-CoA hydratase ⁄ 3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme [10], a-fetoprotein [11] and rat apoAI [12] genes Rev-erba is also involved in circadian timing in brain and liver tissue, and regulates Bmal1 which is the master regulator of circadian rhythm in mammals [13–16] However, it is not known whether Rev-erbb is involved in circadian regulation Rev-erb also represses the expression of apoCIII [17] ApoCIII is a 79-residue glycoprotein It is synthesized in the liver as part of the very low density lipoprotein (VLDL) It is well established that the plasma concentration and synthesis rate of apoCIII are positively correlated with plasma triacylglycerols in both normal and hypertriglyceridaemic subjects [18–20] Large scale clinical trials have indicated that hypertriglyceridaemia is an independent risk factor for coronary artery disease and atherosclerosis [21,22] Therefore, a better understanding of the regulation of the expression of the apoCIII gene is of major importance for the treatment of dyslipidaemia In this study, a zinc finger HIT domain-containing protein, ZNHIT-1 (NM_006349.2), was found to interact with Rev-erbb by a yeast two-hybrid assay The sequence of ZNHIT-1 was first identified by high throughput genomic sequences in humans This protein contains a conserved zinc finger HIT domain originally found in the yeast HIT-1 protein [23], and so has been named ZNHIT-1 (‘zinc finger HIT domain-containing protein 1’) Previous knowledge about the function of ZNHIT-1 is limited One report has described ZNHIT-1 as a subunit of the SNF-2 related CBP activator protein (SRCAP) complex, which can remodel chromatin by incorporating the histone variant H2A.Z into nucleosomes [24] The interaction between ZNHIT-1 and Rev-erbb was further confirmed using a glutathione S-transferase (GST) pull-down assay and a coimmunoprecipitation (Co-IP) assay In addition, the homologues and tissue distribution of ZNHIT-1 were analysed Furthermore, a nuclear localization signal (NLS) of ZNHIT-1 was identified Using the chromatin immunoprecipitation (ChIP) assay, we found that ZNHIT-1 was recruited to the human apoCIII promoter by Rev-erbb, and subsequently removed Rev-erbb-induced inhibition of apoCIII transcription without changing the DNAbinding activity of Rev-erbb ZNHIT-1 as a cofactor of Rev-erbb Results Yeast two-hybrid screening In order to identify Rev-erbb binding partners, a human fetal liver cDNA library was screened in a yeast twohybrid assay using Rev-erbb as bait A screen of approximately 106 yeast transformants revealed that ZNHIT-1 interacted with Rev-erbb The zinc finger HIT domain is a motif found in many proteins, and plays an important role in gene regulation and chromatin remodelling [25] So far, five human proteins containing the HIT domain have been identified A phylogenetic tree was constructed to show the relationship between ZNHIT-1 and other members of the zinc finger HIT domain proteins According to the evolutionary distance between the ZNHIT protein members, estimated from our phylogenetic analysis, it was concluded that a close relationship existed between ZNHIT-1 and ZNHIT-4, as well as between ZNHIT-3 and ZNHIT-5 (see Supplementary material Fig S1) A liquid assay for b-galactosidase activity was further performed to establish the interaction between Reverbb and ZNHIT-1 As shown in Fig 1, the Rev-erbb homodimer was used as a positive control ZNHIT-1 and Rev-erbb cotransformants showed a stronger b-galactosidase activity than the Rev-erbb homodimer, whereas almost no b-galactosidase activity was detected in ‘no insert’ or lamin-negative control vectors Homologues and tissue distribution analysis of human ZNHIT-1 blastp of human ZNHIT-1 was performed at National Center for Biotechnology Information (NCBI) sites, Fig Evaluation of the interaction strength by a relative b-galactosidase activity assay The homodimer of Rev-erbb was used as a positive control No insert or lamin was used as a negative control Results are the means ± SD of three independent experiments performed in triplicate ‘BD’ and ‘AD’ represent the DNA-binding domain in pGBKT-7 and the DNA activation domain in pADKT-7, respectively These domains were fused with target proteins FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5371 ZNHIT-1 as a cofactor of Rev-erbb J Wang et al A B Fig Homologue and expression analysis of human ZNHIT-1 (A) Sequence comparison of human ZNHIT-1 and its homologues in Canis familiaris, Mus musculus, Xenopus tropicalis, Danio rerio, Drosophila melanogaster and Schizosaccharomyces pombe (GenBank accession nos XP_536855.2, Q8R331, NP_001017056.2, NP_001017401.1, NP_608895.1 and NP_595833.1) Residues identical in all compared sequences are presented on a black background, whereas residues similar in four or more compared sequences are presented on a grey background (B) The relative expression levels of ZNHIT-1 mRNA in 16 human tissues (human multiple tissue cDNA panels and from Clontech) determined by real-time quantitative PCR using b2-microglobulin as a reference standard and homologues were identified in dog, mouse, frog, zebra fish, fruit fly and yeast As shown in Fig 2A, human ZNHIT-1 encodes a full-length protein of 154 amino acids and shares high identity with its homologues (100% with Canis familiaris, 97% with Mus musculus, 87% with Xenopus tropicalis, 87% with Danio rerio, 68% with Drosophila melanogaster and 33% with Schizosaccharomyces pombe), indicating that ZNHIT-1 is a conservative protein in eukaryotes To investigate the tissue distribution of ZNHIT-1, a real-time quantitative PCR was performed with human multiple tissue cDNA panels and from 16 human tissues (Catalogue # 636742, 636752; Clontech, Tokyo, Japan) as templates ZNHIT-1 was expressed in all analysed tissues, abundantly in human liver, but weakly in skeletal muscle, ovary and small intestine (Fig 2B) Subcellular localization analysis of ZNHIT-1 Bioinformatic analyses by PSORT and other databases failed to predict the potential localization of ZNHIT-1 5372 To examine the subcellular localization of ZNHIT-1 proteins, Hela and HepG2 cells were transfected with expression vectors for pEGFPC1-ZNHIT-1 or pDSRED1C1-ZNHIT-1 Their subcellular localization was visualized by laser microscopy Similar results were obtained from both types of cell As shown in Fig 3A,B for Hela cells, both red fluorescent protein (RFP)-ZNHIT-1 and green fluorescent protein (GFP)ZNHIT-1 accumulated in the nucleus and exhibited a punctate distribution To map the ZNHIT-1 NLS, serial deletion mutants of ZNHIT-1 were constructed (Fig 3E) Like the fullsized protein, the ZNHIT-1 (1–54) mutant was localized exclusively in the nucleus of Hela cells In contrast, the ZNHIT-1 (54–154) mutant, without the NH2-terminus, was localized in both the nucleus and cytoplasm, similar to the empty GFP vector Further deletions in ZNHIT-1 (1–54) showed that amino acids 38–47 were sufficient for the nuclear localization of ZNHIT-1 (Fig 3C) Alignment, even with yeast ZNHIT-1, revealed that four amino acids FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al A ZNHIT-1 as a cofactor of Rev-erbb A B B C C D E Fig Subcellular localization analysis of ZNHIT-1 in Hela cells (A) Nuclear localization of RFP-ZNHIT-1 (B) Nuclear localization of GFP-ZNHIT-1 (C) Nuclear localization of GFP-ZNHIT-1 (38–47) (D) Cytoplasmic and nuclear localization of GFP-ZNHIT-1 NLS mutant (E) Subcellular localization of various ZNHIT-1 deletion mutants (38DNFxD42) of ZNHIT-1 were highly conserved Substitution mutations of these conserved amino acids decreased the nuclear localization of ZNHIT-1 (Fig 3D) Collectively, the data in Fig established that the fragment 38DNFQDDPHAG47 of ZNHIT-1 contains a putative NLS, which is sufficient to target ZNHIT-1 into the nucleus Characterization of the interaction between ZNHIT-1 and Rev-erb The interaction between Rev-erbb and ZNHIT-1 was further verified by a GST pull-down assay and a Fig Validation of the interaction between ZNHIT-1 and Reverbb or Rev-erba (A) The GST pull-down assay in vitro GST-ZNHIT-1 or GST immobilized on the beads was incubated with 6His-Rev-erbb Interacting proteins were immunoblotted with anti-6His serum Lane is the input, which acts as a positive control (B) The interaction between ZNHIT-1 and Rev-erbb validated by a Co-IP assay HepG2 cells were transfected with pCMV-Myc-ZNHIT-1 Expression of Myc-ZNHIT-1 in transfected cells was analysed by western blotting Cell lysates were then precipitated by anti-Myc serum The precipitated proteins were eluted from the protein A ⁄ G PLUS agarose and analysed by western blotting using anti-Rev-erbb serum HC represents the heavy chain of mouse IgG (C) The interaction between ZNHIT-1 and Rev-erba validated by a Co-IP assay HepG2 cells were cotransfected with Myc-ZNHIT-1 and pCMV-HA-Rev-erba LC represents the light chain of mouse IgG Co-IP assay As shown in Fig 4A, bacterially expressed GST-ZNHIT-1, when conjugated to glutathione–Sepharose beads, efficiently and specifically pulled down 6His-tagged Rev-erbb, which was about 66 kDa Conversely, GST alone did not In the Co-IP assay, anti-Myc serum and protein A ⁄ G agarose were added to the HepG2 cell lysates containing overexpressed Myc-ZNHIT-1 so as to precipitate the Myc-ZNHIT-1 ⁄ Rev-erbb complex, and anti-Rev-erbb serum was used in western blotting to detect Rev-erbb in the precipitate As shown in Fig 4B, endogenous Rev-erbb interacted with ZNHIT-1 in mammalian cells It is well known that Rev-erba is closely related to Rev-erbb, especially in the DNA-binding domain and putative ligand-binding domain (LBD) In order to FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5373 ZNHIT-1 as a cofactor of Rev-erbb J Wang et al determine whether Rev-erba could also interact with ZNHIT-1, Rev-erba was amplified from a human fetal liver cDNA library, and a Co-IP assay between Reverba and ZNHIT-1 was performed As shown in Fig 4C, Rev-erba was also capable of binding ZNHIT-1 A B C D E 5374 Mapping the regions of interaction between ZNHIT-1 and Rev-erbb Rev-erbb consists of five domains: A ⁄ B, C, D and E [5] The highly conserved region C is responsible for DNA binding, and region E contains a putative LBD and mediates the recruitment of cofactors [5] To identify the region of Rev-erbb essential for the interaction with ZNHIT-1, serial deletion assays were performed using the yeast two-hybrid method N- and C-terminal deletion constructs of Rev-erbb (Fig 5A) were fused in-frame to the Gal4-binding domain and tested for their abilities to bind ZNHIT-1 by checking the activation of the reporter genes Ade2, His3 and LacZ It was shown that ZNHIT-1 binds specifically to the LBD of Rev-erbb The interaction between ZNHIT-1 and all the serial truncated fragments of Rev-erbb was further confirmed by the GST pull-down in vitro assay (Fig 5B) Similarly, the serial deletion constructs of ZNHIT-1 were fused to the Gal4 activation domain and tested for their abilities to bind Rev-erbb As shown in Fig 5C, ZNHIT-1D2 (amino acids 72–110) was required for the interaction with Rev-erbb This fragment contains an FxxLL motif (x denotes any amino acid), which has been reported to function in the same manner as an LxxLL motif, and mediates transcriptional coactivator binding to NRs [26–28] To further investigate whether the ZNHIT-1 FxxLL motif was required for the interaction with Rev-erbb, a double L87A ⁄ L88A mutation in the context of full-length ZNHIT-1 was introduced As a result, the mutant of the FxxLL motif failed to interact with Rev-erbb The results from the GST pull-down assay (Fig 5D) were consistent with those from the yeast two-hybrid assay Fig Mapping the regions for the interaction between Rev-erbb and ZNHIT-1 (A) The Rev-erbb region required for interaction with ZNHIT-1 was revealed by a yeast two-hybrid assay The serial truncated fragments of Rev-erbb were separately coexpressed with full-length ZNHIT-1 in AH109 (B) Serial truncated fragments of Rev-erbb interacting with ZNHIT-1 were confirmed by a pull-down assay (C) The ZNHIT-1 region required for the interaction with Reverbb was mapped by a yeast two-hybrid assay The serial truncated fragments of ZNHIT-1 were individually coexpressed with full-length Rev-erbb in AH109 The activation of the reporters was analysed (D) All serial truncated fragments of ZNHIT-1 interacting with Reverbb were confirmed by a pull-down assay (E) The interaction between Rev-erbb, ZNHIT-1 and N-CoR GST-ZNHIT-1 was first immobilized on glutathione–Sepharose and was then incubated with 6His-Rev-erbb together with a myc-tagged N-CoR fragment (amino acids 2053–2453 containing IDI + IDII domains) The mixture was incubated at °C for h After three washes with NaCl ⁄ Pi buffer, the sample was boiled and analysed by western blotting using anti-6His or anti-myc FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al The transcriptional repressor, N-CoR, has been reported to interact with Rev-erbb through the E region [5,29] Deletion of one of two fragments (amino acids 394–416 and 561–576) in the E region of Reverbb ablates N-CoR ⁄ Rev-erbb interaction [29] In order to identify whether the region mediating the Rev-erbb ⁄ N-CoR interaction is the same as that mediating the Rev-erbb ⁄ ZNHIT-1 interaction, the amino acid fragment 416–561 (Rev-erbb D6) was tested for its ability to bind to ZNHIT-1 It was shown that Reverbb D6 interacted with ZNHIT-1 (lane in the right panel of Fig 5E), suggesting that the regions mediating the Rev-erbb ⁄ N-CoR and Rev-erbb ⁄ ZNHIT-1 interactions are different As ZNHIT-1 and N-CoR bind to different regions of the E domain of Rev-erbb, the possibility that these three proteins could form a ternary complex exists To answer this question, GSTZNHIT-1 was affinity immobilized on glutathione– Sepharose and incubated with 6His-Rev-erbb and a myc-tagged N-CoR fragment (amino acids 2053–2453 containing IDI + IDII domains) As shown in Fig 5E, ZNHIT-1 could pull-down 6His-Rev-erbb directly, but not the myc-tagged N-CoR fragment, in the presence of Rev-erbb These results suggest that these three proteins could not form a ternary complex in vitro Colocalization of ZNHIT-1 and Rev-erbb in the nucleus To determine whether the interaction between ZNHIT-1 and Rev-erbb might be of physiological relevance in mammalian cells, the subcellular localization and distribution of ZNHIT-1 and Rev-erbb in Hela and HepG2 cells were assessed using laser microscopy Similar results were obtained from both types of cell GFP-Rev-erbb accumulated in the nucleus and exhibited a diffuse distribution (Fig 6A) As shown in Fig 6B, confocal images of cells expressing wild-type RFP-ZNHIT-1 and GFP-Rev-erbb indicated that both proteins were nuclear and that the majority of these expressed proteins were colocalized in Hela cells To extend this observation, coexpression studies with Reverbb and the ZNHIT-1 NLS mutant were performed As illustrated in Fig 3D, the ZNHIT-1 NLS mutant was expressed in both the cytoplasm and nucleus in Hela cells without transfection of Rev-erbb Surprisingly, in cells with coexpressed ZNHIT-1 mutant and RFP-Rev-erbb, the ZNHIT-1 NLS mutant adopted a predominantly nuclear expression profile and colocalized with Rev-erbb (Fig 6C) Thus, these data provide additional evidence that Rev-erbb interacts with ZNHIT-1 in the nucleus, and implies that this interac- ZNHIT-1 as a cofactor of Rev-erbb A B C Fig Colocalization of ZNHIT-1 and Rev-erbb in Hela cells (A) Nuclear localization of GFP-Rev-erbb (B) Colocalization of RFPZNHIT-1 and GFP-Rev-erbb (C) Effect of Rev-erbb on the localization of the ZNHIT-1 NLS mutant Hela cells were cotransfected with RFP-Rev-erbb and GFP-ZNHIT-1 NLS mutant tion with Rev-erbb recruits the cytoplasmic ZNHIT-1 NLS mutant into the nuclear compartment Recruitment of ZNHIT-1 by Rev-erbb to the apoCIII promoter and its effect on the apoCIII promoter Rev-erbb has been reported to repress the expression of apoCIII [17] To extend this observation, Rev-erbb was found to bind to the promoter of apoCIII in vivo (Fig 7A) and to function as a transcriptional silencer (Fig 7B) To study the effect of the interaction between ZNHIT-1 and Rev-erbb on the Rev-erbbmediated transcription of apoCIII, recruitment of ZNHIT-1 to the apoCIII promoter was first studied No ZNHIT-1 was detectable in association with the apoCIII promoter in the absence of transfected Reverbb However, a relatively strong association of ZNHIT-1 with the apoCIII promoter was detected after transfection of Rev-erbb These results suggest that Rev-erbb is essential to recruit ZNHIT-1 to the apoCIII promoter (Fig 7A) In order to further address the functional significance of ZNHIT-1-mediated regulation on Rev-erbb, HepG2 cells expressing endogenous ApoCIII were transiently transfected with HA-Rev-erbb and either Myc-ZNHIT-1 or empty vector, together with the pGL3-apoCIII-pro reporter, which contains the promoter of the human apoCIII gene (nucleotides )1408 to +24) and pRL As illus- FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5375 ZNHIT-1 as a cofactor of Rev-erbb J Wang et al Fig Recruitment of ZNHIT-1 by Rev-erbb to the apoCIII promoter and its effect on the apoCIII promoter (A) Recruitment of ZNHIT-1 by Rev-erbb to the apoCIII promoter A ChIP assay of the apoCIII promoter was performed in human HepG2 cells with the indicated antibodies Promoter-specific primers are described in ‘Experimental procedures’ (B) The effect of ZNHIT-1 on Rev-erbb activity was assessed by a luciferase assay HepG2 cells were cotransfected with pGL3-apoCIII-pro and pRL, as well as the plasmid or plasmids as indicated Plasmid pRL was used to normalize the transfection efficiencies, and the empty vector pCMV-HA was used as a negative control All luciferase activities are the means ± SD of three independent experiments performed in triplicate (C) The effect of ZNHIT-1 on endogenous apoCIII expression was analysed by realtime PCR with total RNA from the stable knock-down of ZNHIT-1 cells The mRNA levels of ZNHIT-1 and apoCIII were normalized to the endogenous b2-microglobulin mRNA level A B the binding of Rev-erbb Furthermore, ZNHIT-1 D4, without the zinc finger HIT domain, did not remove the inhibition of apoCIII (Fig 7B), indicative of the requirement of the HIT domain in ZNHIT-1-mediated coregulation To further evaluate the effect of ZNHIT-1 on apoCIII expression in vivo, HepG2 cell lines with stable ZNHIT-1 siRNA expression were established These HepG2 RNAi cell lines showed a significant decrease in mRNA expression of the endogenous ZNHIT-1 genes, as measured by quantitative real-time PCR The apoCIII level was also measured by quantitative realtime PCR As shown in Fig 7C, the endogenous apoCIII level was reduced to about 70% in the HepG2 cell line with stable ZNHIT-1 siRNA expression, suggesting that endogenous ZNHIT-1 affects apoCIII transcription C No change in Rev-erbb DNA-binding activity to the apoCIII promoter by ZNHIT-1 trated in Fig 7B, overexpression of Rev-erbb repressed the expression of apoCIII by approximately 60%, and the repression was totally removed by coexpressed ZNHIT-1 In contrast, the L87A ⁄ L88A mutant of ZNHIT-1 did not relieve the repression, suggesting that ZNHIT-1-mediated regulation is dependent on 5376 Next, the possible effect of ZNHIT-1 on the binding capacity of Rev-erbb to the apoCIII promoter was investigated ChIP analysis using anti-Rev-erbb serum was performed in HepG2 cells transfected with Rev-erbb alone or cotransfected with Rev-erbb and ZNHIT-1 The binding capacity of Rev-erbb to the apoCIII promoter was assessed by quantitative PCR for ChIP DNA As shown in Fig 8, ZNHIT-1 did not affect Rev-erbb binding to the apoCIII promoter These results indicate that Rev-erbb remains on the apoCIII promoter after recruitment of ZNHIT-1 Discussion It is well known that Rev-erb is involved in lipid metabolism by the regulation of apoCIII transcription FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al Fig No effect of ZNHIT-1 on Rev-erbb DNA-binding activity to the apoCIII promoter Quantitative PCR for ChIP products precipitated with anti-Rev-erbb serum was performed using promoterspecific primers The relative ChIP DNA level was normalized against the input DNA The ApoCIII protein is a major component of VLDL and plays a key role in hypertriglyceridaemia [18–20] Human Rev-erba and Rev-erbb specifically repress apoCIII gene expression in rats and humans [17,30] Rev-erba null mutant mice have elevated VLDL triacylglycerol and ApoCIII [31] Cofactors that interact with Rev-erb and modify its effect on transcription will no doubt be involved in the regulation of its target genes One corepressor, N-CoR, has been reported to interact with Rev-erba and Rev-erbb and, consequently, to intensify the transcriptional repression [6,9] However, no study has reported on how the transcriptional repression mediated by Rev-erba or Reverbb can be removed In this study, it has been shown that ZNHIT-1 can interact with Rev-erbb and relieve its inhibitory effect on the transcription of apoCIII Interestingly, ZNHIT-1 is highly abundant in the liver (Fig 2B) where ApoCIII is synthesized Thus, it is plausible that ZNHIT-1 can affect lipid metabolism However, further experimentation will be needed to confirm this assumption ZNHIT-1 was identified as a nuclear protein Serial truncated fragments and substitution mutations established a putative NLS in amino acids 38–47 of ZNHIT-1 Furthermore, the ZNHIT-1 NLS mutant ZNHIT-1 as a cofactor of Rev-erbb was expressed in both the cytoplasm and nucleus Interestingly, in cells that coexpressed the ZNHIT-1 NLS mutant together with Rev-erbb, the ZNHIT-1 NLS mutant adopted a predominantly nuclear expression profile This shuttling of the ZNHIT-1 NLS mutant to the nucleus was selective for Rev-erbb expression, as the expression of another nuclear protein, such as p53, did not alter the cytoplasmic localization of the ZNHIT-1 NLS mutant (data not shown) Thus, these data provide evidence that the interaction with Rev-erbb recruits the cytoplasmic ZNHIT-1 NLS mutant to the nuclear compartment Many cofactors bind to a common LBD region of NRs to regulate transcription These cofactors usually contain a short conserved LxxLL motif, which was originally identified in the NR-interacting domain of transcriptional intermediary factor 1a [26], and subsequently found in other putative NR coactivators [27,28] Furthermore, LxxLL appears to be both necessary and sufficient for such interactions [26] However, some NR-binding proteins, such as NR-binding SET domaincontaining protein, also contain a variant motif FxxLL that is responsible for ligand-dependent binding of NRs [32] In ZNHIT-1, a segment extending from residue 72 to residue 110 is required for interaction with Rev-erbb, and is predicted to form an a-helix This segment contains the FxxLL motif Our data show that the FxxLL motif of ZNHIT-1 is required for the binding of ZNHIT-1 to Rev-erbb.The analysis of homologues showed that ZNHIT-1 is conserved in eukaryotes In particular, its six cysteines are absolutely conserved from humans to yeast Interestingly, ZNHIT-1 D4, without the zinc finger HIT domain, did not remove the inhibitory effect of Rev-erbb on the transcription of apoCIII (Fig 7B) This suggests that the HIT domain is a functional activity domain for ZNHIT-1 Rev-erbb is a transcriptional silencer and does not possess an activation domain; however, it does contain a transcriptional silencing domain in the C-terminal putative LBD [5] ChIP assay showed that Rev-erbb could recruit ZNHIT-1 to the apoCIII promoter (Fig 7A), and this recruitment did not modulate Reverbb DNA-binding activity (Fig 8) Furthermore, ZNHIT-1 removed the repression of apoCIII induced by Rev-erbb (Fig 7B) The function of ZNHIT-1 was dependent on the presence of the FxxLL motif for binding to Rev-erbb through its interaction with LBD (Fig 5), and the HIT domain for its activity (Fig 7B) Like Rev-erbb, Rev-erba was also capable of binding ZNHIT-1 (Fig 4C) It is well known that Rev-erba is a major player in the circadian rhythm However, ZNHIT-1 expression in the liver and heart was not circadian in an extensive and divergent circadian gene FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5377 ZNHIT-1 as a cofactor of Rev-erbb J Wang et al expression study [33] In order to further verify this, mRNA of mouse liver was extracted every h for 30 h, and real-time quantitative PCR showed that ZNHIT-1 expression was not circadian (data not shown) In addition to ZNHIT-1, we recently found that Rev-erbb could interact with different cofactors, including coactivators such as histone acetyl-transferase and corepressors such as histone deacetylase (J Wang et al., School of Life Sciences, Fundan University, Shanghai, China, unpublished results) In the case of ‘classical’ NRs, NRs recruit corepressors to repress transcription in the absence of ligands In contrast, ligand binding induces a conformational change of the receptor, excludes corepressors from the complex and leads to the binding of coactivators instead However, Rev-erbb is an orphan NR, whose ligands, if any, have not been identified Reinking et al [34] have shown that the ligand-binding pocket of E75, a Drosophila orthologue of human Rev-erb, is tightly bound by haem Haem binding of E75 can be disrupted by mutating the two most highly conserved histidine residues in the LBD, and these two residues are also present in the vertebrate orthologue of E75, Rev-erba and Rev-erbb Interestingly, they also identified E75 as a potential gas sensor, and showed that CO or NO binds to E75 to interfere with E75-mediated repression All of the above findings suggest that there may be certain unidentified ligands which may regulate the activity of Rev-erbb and control the recruitment of different cofactors The mechanism by which ZNHIT-1 removes the Rev-erbb-induced inhibition of transcription remains unclear Most cofactors affect transcription through direct regulation of chromatin remodelling or recruitment of other chromatin remodelling proteins Human ZNHIT-1 shares 30% identity with Vps71 (P46973) from Saccharomyces cerevisiae and 67% identity with its HIT domains Vps71 is a subunit of the SWR1 chromatin remodelling complex that incorporates the histone variant H2A.Z into nucleosomes [35] The histone variant H2A.Z is implicated in transcription activation and the prevention of ectopic spread of heterochromatin [36] Cai et al [24] reported that the ZNHIT-1 protein was a subunit of the SRCAP complex, which is the closest mammalian homologue of SWR1 Recent research has found that the human SRCAP complex can remodel chromatin and activate gene transcription [37] The above findings imply that ZNHIT-1 may affect transcriptional regulation through the recruitment of a chromatin remodelling complex Further studies are needed to clarify the molecular mechanism underlying the activation of apoCIII by ZNHIT-1 5378 In summary, a zinc finger HIT domain-containing protein, ZNHIT-1, interacted with Rev-erbb The FxxLL motif of ZNHIT-1 and the putative LBD of Rev-erbb were required for this interaction Furthermore, ZNHIT-1 was recruited to the apoCIII promoter by Rev-erbb and relieved the transcriptional repression of Rev-erbb These findings indicate that ZNHIT-1 functions as a cofactor to regulate the activity of Rev-erbb, possibly by chromatin remodelling Experimental procedures Plasmid construction and protein expression The coding sequence (CDS) of human Rev-erbb was amplified from the human marathon liver cDNA library (Clontech, Tokyo, Japan) by PCR and subcloned into pET28a (catalogue # 69864-3; Novagen, Darmstadt, Germany) and pCMV-HA (Clontech) vectors The CDS of human ZNHIT-1 was amplified from the human liver cDNA library (Clontech) by PCR and subcloned into pGEX4T-3 (catalogue # U13855; Pharmacia Biotech, Piscataway, NJ, USA) and pCMV-Myc (Clontech) vectors ZNHIT-1 L87A ⁄ L88A was generated by PCR, and subsequently cloned into pEGX4T-3 and pCMV-Myc vectors pET28aRev-erbb, pGEX4T-3-ZNHIT-1 and plasmids containing serial truncated fragments were expressed in Escherichia coli strain BL21 DE3 The purification of protein was performed according to the manufacturer’s instructions (Novagen) Yeast two-hybrid screening Yeast two-hybrid screening was performed as described previously [37] Briefly, the yeast two-hybrid screen was carried out using the Matchmaker Two-hybrid system (Clontech) Rev-erbb was used as bait to screen the human fetal liver cDNA library (Clontech) The mating test was used to pick out the specific interaction between bait and prey GST pull-down assay GST-ZNHIT-1 and GST-ZNHIT-1 fragment fusion proteins were expressed in bacteria and purified on glutathione– Sepharose (catalogue # 17-0757-01; Pharmacia) as specified by the manufacturer The 6His-tagged Rev-erbb and Reverbb fragments were expressed in bacteria and purified on nickel nitrilotriacetic acid agarose (catalogue # 30210; Qiagen, Venlo, the Netherlands) GST pull-down assays were performed as described previously [37] Co-IP assay For the determination of the interaction between ZNHIT-1 and Rev-erbb, HepG2 cells were transfected with Myc- FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al ZNHIT-1 The lysate was first precipitated with anti-Myc and then detected with anti-Rev-erbb The interaction between ZNHIT-1 and Rev-erba was assessed using HepG2 cells cotransfected with Myc-ZNHIT-1 and pCMVHA-Rev-erba Anti-HA and anti-Myc were used for precipitation and detection, respectively The Co-IP assay was carried out as described previously [38] Subcellular localization analysis The complete open reading frames of Rev-erbb and ZNHIT-1 were constructed in-frame in the plasmids pEGFP and pDsRed, respectively Hela and HepG2 cells grown on coverslips were transiently transfected with plasmids pEGFP-Rev-erbb and pDsRed-ZNHIT-1, or cotransfected with both plasmids After 36 h of transfection, the cells were fixed with 4% formaldehyde and stained with lgỈmL)1 of 4¢,6¢-diamidino-2-phenylindole to visualize the nuclei with an Olympus IX71 laser microscope Luciferase reporter gene assay The promoter of the human apoCIII gene (nucleotides )1408 to +24) was obtained from human genomic DNA by PCR and subcloned into the promoter-less luciferase reporter plasmid pGL3-basic (catalogue # E1751; Promega, Madison, WI, USA), generating pGL3-apoCIII-pro HepG2 cells were cotransfected using FuGENE reagent (catalogue # 11814443001; Roche, Basel, Switzerland) with 100 ng of apoCIII promoter-driven luciferase expression plasmid pGL3-apoCIII-pro and the indicated amount of human Rev-erbb-expressing plasmid pCMV-Rev-erbb, as well as 10 ng of pRL (sea pansy) as an internal control for transfection efficiency The dosage of transfected plasmids in one well was kept constant by the addition of appropriate amounts of the empty vector pCMV After 36 h, the cells were lysed by 200 lL of Promega lysis buffer for 10 at room temperature Firefly and Renilla luciferase activities were measured using a Dual-LuciferaseÒ Reporter Assay Kit (catalogue # 192445; Promega) on a Lumistar luminometer (BMG Laboratory Technologies, Offenburg, Germany) Firefly luciferase activity values were divided by Renilla luciferase activity values to obtain normalized luciferase activities To facilitate comparisons within a given experiment, the activity data were presented as relative luciferase activities The final relative activity was calculated from three independent experiments performed in triplicate ChIP assay HepG2 cells were cotransfected with lg of pCMV-Reverbb and either pCMV-ZNHIT-1 or pCMV vector After incubation, ChIP assay and PCR were performed as described previously [39] The primers for PCR were ZNHIT-1 as a cofactor of Rev-erbb designed to ensure specific amplification of a 230-bp fragment of the apoCIII promoter, with the forward primer (TCTCCTAGGGATTTCCCAACTCTCC) and the reverse primer (CTGCCTCTAGGGATGAACTGAGCAG) Quantitative real-time PCR was performed as described previously [40] Quantitative PCR for ChIP products precipitated with anti-Rev-erbb serum was performed using promoter-specific primers The relative ChIP DNA level was normalized against the input DNA Stable knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA CTGAGGCAGTCTCG-3¢ These oligonucleotides were annealed and subcloned to downstream of the U6 promoter in pGCsi-U6 ⁄ Neo ⁄ GFP (Genechem, Shanghai, China) using HindIII and BamHI The empty plasmid or RNAi plasmid was transfected into HepG2 cells using Fugene-HD transfect reagent (catalogue # 93539521; Roche) After day of incubation, media from all plates were replaced with selective medium containing 300 lgỈmL)1 of Geneticin (Gibco ⁄ BRL, Grand Island, NY, USA) Cells were grown in selective media for weeks, and G418-resistant colonies were established in six-well plates, expanded and cloned independently Acknowledgements This work was supported by grants from the National Nature Science Foundation of China (NSFC 30671175 and 30370752) and from the Specialized Research Fund for the Doctoral Program of High Education (SRFDP 20060246017) References Robinson-Rechavi M, Escriva Garcia H & Laudet V (2003) The nuclear receptor superfamily J Cell 116, 585–586 Rosen J, Marschke K & Rungta D (2003) Nuclear hormone receptor assays for drug discovery Curr Opin Drug Discov Devel 6, 224–230 Smith CL & O’Malley BW (2004) Coregulator function: a key to understanding tissue specificity of selective receptor modulators Endocr Rev 25, 45–71 Lazar MA, Hodin RA, Darling DS & Chin WW (1989) A novel member of the thyroid ⁄ steroid hormone receptor family is encoded by the opposite strand of the rat c-erbA alpha transcriptional unit Mol Cell Biol 9, 1128–1136 Burke L, Downes M, Carozzi A, Gigue’re V & Muscat GE (1996) Transcriptional repression by the FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5379 ZNHIT-1 as a cofactor of Rev-erbb 10 11 12 13 14 15 16 J Wang et al orphan steroid receptor Rev-erbb ⁄ Rev-erb beta is dependent on the signature motif and helix in the E region: functional evidence for a biological role of Rev-erbb in myogenesis Nucleic Acids Res 24, 3481– 3489 Downes M, Burke LJ, Bailey PJ & Muscat GE (1996) Two receptor interaction domains in the corepressor, N-CoR ⁄ RIP13, are required for an efficient interaction with Rev-erbA alpha and Rev-erbb: physical association is dependent on the E region of the orphan receptors Nucleic Acids Res 24, 4379–4386 Adelmant G, Be’gue A, Stehelin D & Laudet V (1996) A functional Rev-erb responsive element located in the human Rev-erb promoter mediates a repressing activity Proc Natl Acad Sci USA 93, 3553–3558 Dussault I & Giguere V (1997) Differential regulation of the N-myc proto-oncogene by ROR alpha and Reverbb, two orphan members of the superfamily of nuclear hormone receptors Mol Cell Biol 17, 1860– 1867 Yin L & Lazar MA (2005) The orphan nuclear receptor Rev-erbalpha recruits the N-CoR ⁄ histone deacetylase corepressor to regulate the circadian Bmal1 gene Mol Endocrinol 19, 1452–1459 Kassam A, Capone JP & Rachubinski RA (1999) Orphan nuclear hormone receptor RevErb modulates expression from the promoter of the hydratase-dehydrogenase gene by inhibiting peroxisome proliferator-activated receptor a-dependent transactivation J Biol Chem 274, 22 895–22 900 Bois-Joyeux B, Chauvet C, Nacer-Che’rif H, Bergeret W, Mazure N, Gigue’re V, Laudet V & Danan JL (2000) Modulation of the far upstream enhancer of the rat a-fetoprotein gene by members of the RORa, Reverba and Rev-erbb groups of monomeric orphan nuclear receptors DNA Cell Biol 19, 589–599 Vu-Dac N, Chopin-Delannoy S, Gervois P, Bonnelye E, Martin G, Fruchart JC, Laudet V & Staels B (1998) The nuclear receptors peroxisome proliferator-activated receptor alpha and Rev-erbalpha mediate the speciesspecific regulation of apolipoprotein AI expression by fibrates J Biol Chem 273, 25 713–25 720 Balsalobre A, Damiola F & Schibler U (1998) A serum shock induces circadian gene expression in mammalian tissue culture cells Cell 93, 929–937 Delaunay F, Thisse C, Marchand O, Laudet V & Thisse B (2000) An inherited functional circadian clock in zebrafish embryos Science 289, 297–300 Triqueneaux G, Thenot S, Kakizawa T, Antoch MP, Safi R, Takahashi JS, Delaunay F & Laudet V (2004) The orphan receptor Rev-erbalpha gene is a target of the circadian clock pacemaker J Mol Endocrinol 33, 585–608 Preitner N, Damiola F, Lopez-Molina L, Zakany J, Duboule D, Albrecht U & Schibler U (2002) The 5380 17 18 19 20 21 22 23 24 25 26 27 28 orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator Cell 110, 251–260 Coste H & Rodriguez JC (2002) Orphan nuclear hormone receptor Rev-erbalpha regulates the human apolipoprotein CIII promoter J Biol Chem 277, 27 120–27 129 Shachter NS (2001) Apolipoproteins C-I and C-III as important modulators of lipoprotein metabolism Curr Opin Lipidol 12, 297–304 Assmann G, Schulte H & von Eckardstein A (1996) Hypertriglyceridemia and elevated lipoprotein (a) are risk factors for major coronary events in middle-aged men Am J Cardiol 77, 1179–1184 Krauss RM (1998) Atherogenicity of triglyceride-rich lipoproteins Am J Cardiol 81, 13B–17B Hasty AH, Shimano H, Osuga J & Yamada N (2001) Severe hypercholesterolemia, hypertriglyceridemia, and atherosclerosis in mice lacking both leptin and the low density lipoprotein receptor J Biol Chem 276, 37 402– 37 408 Tybjaerg-Hansen A, Nordestgaard BG, Gerdes LU, Faergeman O & Humphries SE (1993) Genetic markers in the apo AI-CIII-AIV gene cluster for combined hyperlipidemia, hypertriglyceridemia, and predisposition to atherosclerosis Atherosclerosis 100, 157–169 Galibert F, Alexandraki D, Baur A, Boles E, Chalwatzis N, Chuat J-C, Coster F, Cziepluch C & KarpfingerHartl L (1996) Complete nucleotide sequence of Saccharomyces cerevisiae chromosome X EMBO J 15, 2031– 2049 Cai Y, Jin J, Florens L, Swanson SK, Kusch T, Li B, Workman JL, Washburn MP, Conaway RC & Conaway JW (2005) The mammalian YL1 protein is a shared subunit of the TRRAP ⁄ TIP60 histone acetyltransferase and SRCAP complexes J Biol Chem 280, 13 665–13 670 He F, Umehara T, Tsuda K, Inoue M, Kigawa T, Matsuda T, Yabuki T, Aoki M, Seki E, Terada T et al (2007) Solution structure of the zinc finger HIT domain in protein FON Protein Sci 16, 1577–1587 Le Douarin B, Lade Nielsen A, Garnier J-M, Ichinose H, Jeanmougin F, Losson R & Chambon P (1996) A possible involvement of TIF1a and TIF1b in the epigenetic control of transcription by nuclear receptors EMBO J 15, 6701–6715 Heery DM, Kalkhoven E, Hoare S & Parker MG (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptors Nature 387, 733– 736 Heery DM, Hoare S, Hussain S, Parker MG & Sheppard H (2001) Core LXXLL motif sequences in CREBbinding protein, SRC1, and RIP140 define affinity and selectivity for steroid and retinoid receptors J Biol Chem 276, 6695–6702 FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS J Wang et al 29 Burke LJ, Downes M, Laudet V & Muscat GE (1998) Identification and characterization of a novel corepressor interaction region in RVR and Rev-erbA alpha Mol Endocrinol 12, 248–262 30 Raspe E, Duez H, Mansen A, Fontaine C, Fievet C, Fruchart JC, Vennstrom B & Staels B (2002) Identification of Rev-erbalpha as a physiological repressor of apoC-III gene transcription J Lipid Res 43, 2172–2181 31 Chomez P, Neveu I, Mansen A, Kiesler E, Larsson L, Vennstrom B & Arenas E (2000) Increased cell death and delayed development in the cerebellum of mice lacking the Rev-erbA (a) orphan receptor Development 127, 1489–1498 32 Huang N, vom Baur E, Garnier JM, Lerouge T, Vonesch JL, Lutz Y, Chambon P & Losson R (1998) Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators EMBO J 17, 3398–3412 33 Storch KF, Lipan O, Leykin I, Viswanathan N, Davis FC, Wong WH & Weitz CJ (2002) Extensive and divergent circadian gene expression in liver and heart Nature 417, 78–83 34 Reinking J, Lam MM, Pardee K, Sampson HM, Liu S, Yang P, Williams S, White W, Lajoie G, Edwards A et al (2005) The Drosophila nuclear receptor e75 contains heme and is gas responsive Cell 122, 195–207 35 Krogan NJ, Baetz K, Keogh M-C, Datta N, Sawa C, Hieter TP & Greenblatt JF (2004) Regulation of chromosome stability by the histone H2A variant Htz1, the Swr1 chromatin remodeling complex, and the histone acetyltransferase NuA4 Proc Natl Acad Sci USA 101, 13 513–13 518 ´ 36 Li B, Pattenden SG, Lee D, Gutierrez J, Chen J, Seidel C, Gerton J & Workman JL (2005) Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling Proc Natl Acad Sci USA 102, 18 385–18 390 ZNHIT-1 as a cofactor of Rev-erbb 37 Ruhl DD, Jin J, Cai Y, Swanson S, Florens L, Washburn MP, Conaway RC, Conaway JW & Chrivia JC (2006) Purification of a human SRCAP complex that remodels chromatin by incorporating the histone variant H2A.Z into nucleosomes Biochemistry 45, 5671–5677 38 Shen L, Hu J, Lu H, Wu M, Qin W, Wan DF, Li YY & Gu JR (2003) The apoptosis-associated protein BNIPL interacts with two cell proliferation-related proteins, MIF and GFER FEBS Lett 540, 86–90 39 Reid G, Metivier R, Lin CY, Denger S, Ibberson D, Ivacevic T, Brand H, Benes V, Liu ET & Gannon F (2005) Multiple mechanisms induce transcriptional silencing of a subset of genes, including oestrogen receptor alpha, in response to deacetylase inhibition by valproic acid and trichostatin A Oncogene 24, 4894–4907 40 Hearnes JM, Mays DJ, Schavolt KL, Tang L, Jiang X & Pietenpol JA (2005) Chromatin immunoprecipitationbased screen to identify functional genomic binding sites for sequence-specific transactivators Mol Cell Biol 25, 10 148–10 158 Supplementary material The following supplementary material is available online: Fig S1 A phylogenetic tree showing the relationship between ZNHIT-1 and other zinc finger HIT domain proteins was constructed by neighbour-joining analysis This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 5370–5381 ª 2007 The Authors Journal compilation ª 2007 FEBS 5381 ... against the input DNA Stable knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA... nucleus, and implies that this interac- ZNHIT-1 as a cofactor of Rev-erbb A B C Fig Colocalization of ZNHIT-1 and Rev-erbb in Hela cells (A) Nuclear localization of GFP -Rev-erbb (B) Colocalization of. .. The Authors Journal compilation ª 2007 FEBS J Wang et al A ZNHIT-1 as a cofactor of Rev-erbb A B B C C D E Fig Subcellular localization analysis of ZNHIT-1 in Hela cells (A) Nuclear localization