Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

... knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢- GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA CTGAGGCAGTCTCG-3¢. ... domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb- induced inhibition of apoCIII...

Ngày tải lên: 07/03/2014, 05:20

... mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh Division of Life Science, Graduate School of Natural Science and Technology, Kanazawa ... oligonucleosomal DNA laddering, and complete degradation of the nuclear DNA, with the ultimate outcome of nuclear resorption. Caspase-8- and caspase-9-like...

Ngày tải lên: 20/02/2014, 03:20

... tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model. Feature-based methods (Kambhatla, 2004; Zhou et al., 2005; Zhao and Grishman, 2005 2 ) ... types, 7 major re- lation types and 23 subtypes. Since Zhao and Grishman (2005) use a 5-fold cross-validation on a subset of the 2004 data (newswire and broad- cast news do...

Ngày tải lên: 20/02/2014, 12:20

... EGTA, and 0.09% (w ⁄ v) fatty acid-free BSA. The final concentration of lipid vesicles in assays was 4.2 l M, that of UcPLA 2 was 8 ng, and that of AtxC was 1 ng. Fluorescence was measured with a SAFIRE ... RD, Alves RS, Martins AM, Barbosa PS, Evangelista JS, Evangelista JJ, Ximenes RM, Toyama MH, Toyama DO, Souza AJ et al. (2009) Purification and characterization of the biol...

Ngày tải lên: 06/03/2014, 11:20

... rheumatoid arthritis. Arthritis Rheum 49, 784–788. 21 Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, Yamanaka H, Tomatsu T & Kamatani N (2005) Association between PADI4 and rheumatoid arthritis: ... Yamanaka H, Tanaka E, Urano W, Taniguchi A, Saito T, Hara M, Tomatsu T & Kamatani N (2003) Validation of a Japanese version of the Stanford Health Assessment Questionnaire i...

Ngày tải lên: 16/03/2014, 05:20

... evidence of basal ganglia calcification and extensive high signal changes in the cerebral white matter, consistent with mito- chondrial leukoencephalopathy. Histochemical and biochemical analysis Histological ... phenotypes affecting predo- minantly skeletal muscle, heart and the CNS, which is dependent upon the abundance and segregation of the causative mutation, the gene that i...

Ngày tải lên: 16/03/2014, 22:20

... up. cat(D a red apple ) = LA(cat(D a ), LA(cat(D red ), cat(D apple ))) = LA(LC(cat(D a ), cat(D red )), cat(D apple )) Based on Theorem 2, it follows that combinatory operation of categories has ... language pairs, i.e. Chinese-to-English translation, state -of- the-art hierarchical systems show significant advan- tage over phrasal systems in MT accuracy. For ex- ample, Chiang (2007)...

Ngày tải lên: 17/03/2014, 02:20

... language, the majority of recent research has been based on a traditional WS ap- proach (Nakagawa, 2004). The first step of the traditional approach is to eliminate all spaces in the user input, and then ... Korean lan- guage, many researchers have adopted a traditional WS approach, which eliminates all spaces in the user input and re-inserts proper word boundaries. Unfortunately,...

Ngày tải lên: 17/03/2014, 02:20

... linking accuracy averaged over all the name mentions;  Macro-Averaged Accuracy (Macro- Accuracy): measures entity linking accuracy averaged over all the target entities. As in TAC 2009, ... Wikipedia articles are manually annotated name mentions). In WikiAmbi, there were 207 distinct 950 names and each name contains at least two possible referent entities (on average 6.7 candidate...

Ngày tải lên: 23/03/2014, 16:20

... Mizuno 1 and Takayuki K. Nemoto 2 1 Division of Oral and Maxillofacial Surgery and 2 Division of Oral Molecular Biology, Department of Developmental and Reconstructive Medicine, Course of Medical and ... from Qiagen Inc. (Chatsworth, CA, USA) and expression vector pGEX4T-1, glutathione-Sepharose and low-molecular-mass markers, from Amersham Pharmacia Biotech (Uppsala, Sw...

Ngày tải lên: 23/03/2014, 20:22