a law and economics approach to the equivalence standard of article 22 4 of the dsu
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... oxidase, (C) collagen type V and (D) annexin A1 The migration positions of molecular mass standards and protein loading amounts are indicated IEF ⁄ SDS ⁄ PAGE-based investigation, a commercially ... BLASTP-based protein database searching and functional classification All peptide sequence tags (Table 2) were searched against the dog genome database using BLASTP, version 2.2.16 Database size was...
- 20
- 506
- 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt
... scans, 512 K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 ... pellet was discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [ 24 26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... was set to 2.2 A The cathode surface potential was )1 V and the anode potential was 10 V Both end-plate potentials of the ion trap were set at 1.5 V and the duration of the electron pulse was 100...
- 7
- 491
- 0
báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx
... Representation of the co-linearity between the tomato BAC CU9 145 24. 3 and the potato BAC AC233501.1 Representation of the co-linearity between the tomato BAC CU9 145 24. 3 and the potato BAC AC233501.1 The ... mapped onto the BAC CU9 145 24. 3 from tomato and the BAC AC233501.1 from potato The two BACs are present schematically at the center of the figure and were selected because they share a remarkable ... of accessing and then visualizing Solanaceae EST/TC alignments along the tomato and the potato genomes The mapping of Solanaceae ESTs certainly provides insights into the location of potential...
- 16
- 298
- 0
Báo cáo khoa học: " Towards a sane and rational approach to management of Influenza H1N1 2009" docx
... need to be made using the best information available at the time and will be fallible There can be no standard playbook However, fallible does not mean irrational Even though elected and corporate ... in the field of influenza virology and public health who have made the study and understanding of this viral disease their life's work The WHO, CDC, academic virologists and physicians, and state ... cells and spread through the respiratory tract Its value as a spreading factor is underscored by the fact that the currently licensed antiviral drugs oseltamivir (Tamiflu) and zanamivir (Relenza)...
- 7
- 236
- 0
Báo cáo y học: "A BAC clone fingerprinting approach to the detection of human genome rearrangements" docx
... 46 ,968,650 ar+ bl+ TGCTAAATTTCCCAAGTGCC 20 45 ,7 94, 352 45 ,7 94, 371 TGACACGCAGGGTAGATCAG 20 46 ,923,060 46 ,923,079 ar+ bl- TGCTAAATTTCCCAAGTGCC 20 45 ,7 94, 352 45 ,7 94, 371 TCCAACAGGAAGGAGTACCG 20 46 , 922, 743 46 , 922, 762 ... M0092D11 ar+ br+ TGCTAAATTTCCCAAGTGCC 20 45 ,7 94, 352 45 ,7 94, 371 CCGTCCTCTTAGCGAACTTG 20 46 ,968,3 04 46,968,323 ar+ br- TGCTAAATTTCCCAAGTGCC 20 45 ,7 94, 352 45 ,7 94, 371 AATTTCAAAATGCGTCTGGG 20 46 ,968,631 46 ,968,650 ... br+ al- AATAGAAGCCAGGCATGGTG 20 48 ,861,156 48 ,861,175 ACAACCTGTCCGACCAGAAC 17 56, 646 ,305 56, 646 ,3 24 ar+ cr+ GGACAGAGGCTTTTGTAGCG 17 56,687,628 56,687, 647 ACCACGTAGACAAAGACGGG 20 59,173,9 64 59,173,983...
- 17
- 285
- 0
Báo cáo sinh học: "A marginal quasi-likelihood approach to the analysis of Poisson variables with generalized linear mixed models" pot
... [3], the quasi-likelihood approach only the specification of the marginal mean vector and of the variance requires 11 covariance matrix V of the vector Y of observations Given the moment generating ... sire, and animal models on one hand, and direct and maternal effects on the other hand A simple example of that is the classical animal model In (a2 ! ) x! p + +pi, for the jth performance of the ith ... ith female (eg ovulation rate of an ewe) as a function of = a From as now on GAR referred to as FGI (Foulley, Gianola and Anderson and Rae) (Gilmour, from Im) ; b now on referred to the usual fixed...
- 7
- 274
- 0
A New Institutional Economics Approach To Water Resource Management
... degradation is the result of both natural factors (drought) and man-made factors (mismanagement of water resources) Climatic variability is a feature of Australia as Pigram notes that ‘ [a] t any ... South Australia VIC Victoria x Map of the Murray-Darling Basin1 The Murray-Darling Basin is represented by the area shaded in blue Source: http://www.mda.asn.au/images/Map _of_ Australia _and_ Basin_copy.jpg ... environmental sustainability Contrary to the neo-classical approach, the chapter argues that sustainability is an important and viable goal Furthermore, it is argued that sustainability is both a moral...
- 313
- 296
- 0
DSpace at VNU: A two-step continuous ultrasound assisted production of biodiesel fuel from waste cooking oils: A practical and economical approach to produce high quality biodiesel fuel
... effect of the ultrasound 2 .4 Analysis A 200 mL sample of the reaction mixture was withdrawn from the pipe connecting the ultrasonic reactor and the separation tank, and the sample was stored in a ... weight of FAME in the FAME phase and the weight of WCO used, respectively, MFAME and MWCO are the average molecular weights of the FAME and the WCO, respectively, and the factor indicates that one ... catalyst and excess methanol, was drained from the separation tank On the other hand, the upper layer, mainly FAME, TG and small amounts of DG and MG, was used for the second-step transesterification...
- 8
- 137
- 0
The Republic of Beliefs A New Approach to Law and Economics
... of the law What the focal point approach to law and economics does is to take on the full game of the economy, including the police and the judge, and then tries to explain how and why the law ... focal point approach to law and economics treats all enforcers of the law, those I refer to as functionaries, as part of the game, but it does not treat the act of creating the law as part of the ... monarch announcing a new law 46 12 Concluding Remarks The focus of this paper was law and economics, but it has a larger ambition Much of the paper argued that the traditional approach to law and economics...
- 55
- 514
- 0
ARTICLES: A Behavioral Approach to Law and Economics ppsx
... One of the goals of law and economics is to explain the content of law what the law allows and what it prohibits The traditional approach provides two tools for this analysis First, laws may ... analysis of law. 6 What then is the task of behavioral law and economics? How does it differ from standard law and economics? These are the questions we address below A Homo Economicus and Real ... decisionmaking) May 1998] BEHAVIORAL APPROACH TO LAW & ECONOMICS 148 1 various contexts18 and to the place of shame, pride, and status,19 especially insofar as an understanding of these variables helps...
- 80
- 595
- 0
Tài liệu THE ELGAR COMPANION TO LAW AND ECONOMICS ppt
... Journal of Legal Studies Closer to the Yale approach is the Journal of Law, Economics and Organization A more formal approach is taken by the International Review of Law and Economics and applied ... Backhaus PART I BASICS OF THE LAW AND ECONOMICS APPROACH Coase theorem and transaction cost economics in the law Francesco Parisi Property rights and their partitioning Christian Müller and Manfred ... research Jürgen G Backhaus PART VIII 40 7 42 4 43 3 44 2 45 3 45 9 TOWARDS AN IDEAL ECONOMIC ANALYSIS OF A LEGAL PROBLEM 33 Towards an ideal economic analysis of a legal problem Jürgen G Backhaus PART...
- 777
- 871
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
- 11
- 731
- 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... both the initial fricative and the final plosive at Stage Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates are available, recognition ... student educated in object-oriented design and Windows application programming It uses standard object-class libraries for screen management, standard relational database tools for control of the lexicon ... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal) These elements are phonologically active - they can spread to neighbouring segments,...
- 5
- 337
- 0
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
... Lindahl, Andrew Mansfield, Andrea Neuhoff, Albert Silva, and Kristy Slominski—hammered away at the first draft of the manuscript, especially the first chapter Their feedback was invaluable and ... music, and anthropology, made sure that the book was intelligible to humanists, while Ray, as a psychologist and a journal editor, did the same for the scientists As an editorial tag team that saw ... Since Ray and I met just as I was starting to write and married days after the first draft was completed, I am grateful to him for much more than reading and editing As my companion and conversation...
- 229
- 1,453
- 0
capital structure and firm performance a new approach to testing agency theory and an application to the banking industry
... efficiency, and ECAPi is the ratio of equity capital to gross total assets The use of ECAPi as an inverse measure of leverage is standard in banking research in part because of the regulatory attention ... these additional banks are owner managed rather than professionally managed, and therefore not provide a good laboratory for testing the agency costs of the separation of ownership and management.19 ... Harris, M., and A Raviv, 1990 “Capital Structure and the Informational Role of Debt,” Journal of Finance 45 : 321- 349 Harris, M., and A Raviv, 1991 The Theory of Capital Structure,” Journal of...
- 38
- 561
- 0
Báo cáo nghiên cứu khoa học: " AN APPROACH TO THE EQUIVALENCE PRINCIPLE AND THE NATURE OF INERTIAL FORCES" pptx
... 19 64 [4] V.Fock, The Theory of Space, Time, and Gravitation, trans By N.N Kemmer, 2nd rev.ed., Macmilan, New York, 19 64 [5] S.Weinberg, Gravitation and Cosmology: Principles and Applications of ... which are caused by all matter of universe by means of the background font ϕg0 This satisfies Mach ‘s viewpoint and it also points out way that all matters of universe cause inertial forces Finally, ... uniform gravitational field is not equivalent to central gravitational field by tidal forces so that the principle of equivalence holds only for small regions of space We also find that when the system...
- 6
- 425
- 0
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt
... contact a large number of experts in ARA, made the data collection and processing more efficient while maintaining the safety and anonymity of the information and allowed to provide the participants ... and participated in all stages and tasks All authors have read and approved the final manuscript Filipe Inácio Filomena Falcóo Gra a Castelo-Branco Jaime Correia-Sousa Joóo Almeida Fonseca Josộ ... unrestricted grant from Merck Sharp & Dohme Portugal List of participants in the Final meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos...
- 9
- 370
- 0
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc
... separated the patient and professional groups in order to facilitate frank discussion, and broad and rapid brainstorming To maximize the richness and depth of the data obtained, we used a nominal ... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation to a range of possible interpretations and applications of a tool, there are development ... relevant versus irrelevant variance); and c) the development of a priori, relational hypotheses as a basis for future construct validation The Standards’ contain 24 standards related to validity...
- 39
- 387
- 0
A combinatorial approach to the search for anticonvulsant agents from gou teng and tian ma
... of the alkaloidal extract 46 Total ion chromatogram (TIC) of the alkaloidal extract (A) ; UV spectrum of the alkaloidal extract (B) 47 General structure of corynantheidine type alkaloids (A) and ... from Tian Ma 135 4. 2.2 Instrumental analysis of the extracts 136 4. 2.2.1 Qualitative analysis of the alkaloidal extract by LC-ESI-MS 136 4. 2.2.2 Quantitative analysis of the alkaloidal extract by ... standardized alkaloidal extract from Gou Teng 44 2.1.2.1 Preparation of the alkaloidal extract 45 ii 2.1.2.2 Qualitative analysis of the alkaloidal extract by LC-ESI-MS 46 2.1.2.3 Isolation and characterization...
- 195
- 529
- 0
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... English language The author would also like to thank his parents for their constant support and care Abstract This thesis introduces a novel approach to the analysis and control of a portfolio of ... scant attention has been dedicated to the dynamic management of the approved applicants The present study aims to develop an effective operational strategy to manage customers and, in particular, ... and secondly to the attrition of accounts and to the possible bankruptcy filings Finally an approach unifying the risk sensitivity and the expectation of profitability is formalized and computationally...
- 184
- 497
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25