a high internal consistency reliability coefficient for a test indicates that the items of the test are very similar to each other in content it is important to note that the length of a test can affect internal consistency reliability
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... chinh phục vùng đất ph a Nam bàn tay khối óc mình, cần cù, lam lũ: “Họ to n tiên phong vũ trang óc phiêu lưu mạo hiểm, cán b a, lưỡi cày, lưới ” [59; 60] Hoặc “Nam Kì chinh phục gươm vó ngựa...
- 137
- 853
- 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... insulin-binding protein [6] Although the reported binding of IGFBP-7 to insulin awaits confirmation [7,8], it can compete with insulin for binding to the insulin receptor (InR) and inhibit the autophosphorylation ... consistent with the hypothesis that Imp-L2 acts upstream of the intracellular IIS cascade at the level of the ligands Immunohistochemistry in larval tissues revealed that, besides strong expression in ... conditions Hyperactivation of the dInR pathway leads to increased accumulation of nutrients in adipose tissues, precluding them from circulating and thus resulting in starvation sensitivity at the...
- 11
- 345
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT ... 3¢ )a hTF ⁄ N-lobe AAACTCGAGAGTCCCTGATAAAACTGTGAGATG AAAGCGGCCGCTTAGCATGTGCCTTCCCGTAG AAAGGATCCTGCAAGCCTGTGAAGTGG AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT ... AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT...
- 10
- 308
- 0
báo cáo hóa học:" A Population-Based and Longitudinal Study of Sexual Behavior and Multidrug-Resistant HIV Among Patients in Clinical Care" pdf
... importance, and warrant similar and additional investigation in different populations and geographic areas An additional limitation in the current study was our inability to identify and test partners of ... or without drug-resistant strains engaging in sexual risk behavior are followed in clinical care, targeted prevention and risk reduction strategies situated within the clinical care setting may ... drug-resistant HIV had a substantial amount of continued unprotected sexual risk behavior that could result in HIV transmission In addition to the risk of HIV transmission in general, it is of further...
- 8
- 432
- 0
Báo cáo y học: " Accumulation of major depressive episodes over time in a prospective study indicates that retrospectively assessed lifetime prevalence estimates are too low" potx
... study based on a nationally representative community sample assembled by Statistics Canada (Canada's national statistical agency) in 1994 The target population for the NPHS consisted of house- http://www.biomedcentral.com/1471-244X/9/19 ... episodes This emphasis should perhaps be reversed so that the instruments can obtain a valid and detailed assessment of current mental health status and then assess past history using a smaller ... that refer to lifetime episodes and then explore these episodes in detail, returning to the more recent past through the inclusion of a small number of items asking about the timing of similar...
- 4
- 189
- 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... and activating immune cells, stimulating the release of other proinflammatory mediators and regulating apoptosis In contrast, IL-10 is the paradigmatic anti-inflammatory cytokine It exerts its ... study, carried out DNA testing and participated in the writing of the manuscript RJ and SB participated in the acquisition of the data and performed DNA testing AC conducted data analyses and interpreted ... saving in patients admitted to hospital with sepsis • Timely and adequate antibiotic administration is associated with decreased mortality in patients admitted to the hospital meeting criteria...
- 12
- 293
- 0
Báo cáo y học: "Continuity, psychosocial correlates, and outcome of problematic substance use from adolescence to young adulthood in a community sample" pptx
... Parental Behaviour (PPB) Based on pre-existing literature, we developed an inventory that consisted of 32 items [33] Factor analysis resulted in factors explaining 34% of the variance for mothers ... a total impact score was calculated This was based on a scale attached to each item ranging from -2 to +2 and indicating how unpleasant or pleasant the respective event was [29] The alpha coefficients ... study A more than nine-fold increase of PSU was observed in this period with a slight majority of females in a rather small risk group in early adolescence and a male predominance in males at later...
- 9
- 239
- 0
báo cáo hóa học:" Activation of PKA, p38 MAPK and ERK1/2 by gonadotropins in cumulus cells is critical for induction of EGF-like factor and TACE/ ADAM17 gene expression during in vitro maturation of porcine COCs" doc
... 5'-CAC CAG AAC AAA AAG GTT CTG TC-3' 5'-AAG TCC ATG AAG ACT CAC ACC AT-3' 5'AAG ACA ATC CAC GTG TGG CTC AAG-3' 5'-CGA TTT TTG TAC CAT CTG CAG AAA-3' 5'-GAC ATG AAT GGC AAA TGT GAG AAA C-3' 5'-AGT ... Healthcare) according to the manufacturer's instructions Statistical analysis Statistical analyses of all data from three or four replicates for comparison were carried out by one-way ANOVA followed ... observed as compared with that in COCs cultured with FSH and LH for 2.5 h The respective value of among Areg, Ereg, and Adam17 mRNA were normalized according to those of -actin mRNA to evaluate arbitrary...
- 9
- 388
- 0
Collaboration for Agriculture & Rural Development: Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam " MS6 pot
... condition It is normally higher during daytime and summer time + It is an advantage of water that heat holding capacity is quite high leading to more stable water temperature than embient temperature ... Environment management of culture area and ponds * What water parameters needs monitoring + Pond area, water deapth + Transpearency (by algae density) + pH, alkalinity, salinity + Dissolved oxygen ... Familiar tool to check water temperature is themometer 2.3 Water transparency Water transparency is an indication of: + Algal community + Light panitration In shrimp ponds suitable algal density...
- 19
- 387
- 0
Collaboration for Agriculture & Rural Development: Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS 8 " doc
... Max actual Min actual Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average 33.00 Bold figures indicate that the ... and Nghe An towards the end of the period, An increase in alkalinity in Ha Tinh corresponded to drop in temperature, pH and salinity, and Environmental quality data analysis shows that it is unlikely ... Alkalinity in all water sources generally remained within the safe range of 80-120 mg/l Alkalinity is defined as the sum of exchangeable bases reacting to neutralise acid when an acid is added to water...
- 43
- 326
- 0
Collaboration for Agriculture & Rural Development:: " Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS 9 " pot
... environment issues Small-scale shrimp aquaculture is also required associating individual farm into group in order to reduce constraints and bring into play advantages for example shrimp disease risk ... “centre” of training courses In each training course, the expert provided training materials (handout) and presented the main ideas of the lesson, then trainees were divided into small groups to discuss ... demonstration farm, namely Mr Anh, Mr Ngan and Mr Van trial farms Those aqua-club are managed by Dai Thang aquaculture cooperative V EFFECTIVENESS AND SUSTAINABILITY OF AQUACLUBS/ASSOCIATIONS AS A...
- 51
- 371
- 0
Báo cáo y học: "Evidence of functional selection pressure for alternative splicing events that accelerate evolution of protein subsequences" pps
... variable The appearance of “Ks” in the denominator of the term “Ka/Ks” might seem to imply that changes in Ks can change the value of Ka/Ks, but this is not true in the standard formulation of Ka/Ks, ... results are exactly what is expected under the standard formulation of Ka/Ks, and are not consistent with the hypothesis that decreasing Ks causes increased Ka/Ks in our data Minor-form exons display ... observed increase in Ka/Ks is real, or an artifact of decreasing Ks Specifically, are these data consistent with the standard formulation of Ka/Ks (in which Ka/Ks is independent of Ks, because the...
- 30
- 131
- 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... much attention of both teachers and learners, they are generally less aware of its importance And teaching and learning listening is a really new challenging job It seems that listening is the ... student practice listening in the class they may ask the teacher to repeat the recording Unfortunately, in many cases it is in the teacher’s hands and on his decision and not in hands of the learner ... grammar when learning English Thus, their abilities to speak and listen in English are weak In addition, they learn English in normal classrooms with a cassette It is not easy for them to listen...
- 99
- 805
- 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt
... strains Surprisingly, the microsomal fraction of an extract of the resistant insect D melanogaster also displayed a strong binding capacity The determination of the characteristics of the binding ... neither bovine insulin nor BBI were able to displace PA1b from its binding site, suggesting that the potential binding capacity of PA1b to an insulin binding protein, or a putative similarity with ... of PA1b (named leginsulin in this paper) is able to compete with bovine insulin for binding to a soybean globulin exhibiting functional similarity to the rat insulin receptor In our case, neither...
- 7
- 604
- 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
... involved in the proton translocation step (b) Internal polar cavities in the cytoplasmic domain The cavities identified in this domain trace a clear path that starts in the center of the b-strands forming ... RESULTS AND DISCUSSION Comparison of the ion binding sites in ATC1_RABIT with the equivalent region in PMA1_NEUCR In ATC1_RABIT and other mammalians P-type ATPases [35,36], several amino acids involved ... determinants for control of the gateway to the Ca2+ binding sites by site-directed mutagenesis [51,52] The next cavity in the transmembrane domain is located above the ion-binding site region (cavity...
- 13
- 514
- 0
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx
... were taken for Scatchardanalysis for the determination of Kd values Table Calculated Kd values of the EpoR peptides as determined by Scatchard analysis ND, not determined due to a lack of interaction ... found to act as potential competitor to SHP2 for the binding of the same tyrosine Y759 in the gp130 receptor subunit [16,17] Additionally, it was recently shown that the binding site of SHP2 in the ... N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S & Yoshimura, A (1997) A new protein containing an SH2 domain that inhibits JAK kinases Nature 387, 921–924 Naka, T., Narazaki, M., Hirata,...
- 11
- 579
- 0
báo cáo hóa học: " Validity and internal consistency of a Hausa version of the Ibadan knee/hip osteoarthritis outcome measure" pdf
... All the patients reported clarity of the Hausa language and ease of understanding of all the items The final version of the Hausa translation of IKHOAM (see Additional file 2) The anchors (English) ... validity of Hausa version of IKHOAM since most activity limitations in OA are consequent to pain The VAS has been validated in the Nigerian clinical setting [8,9] Data Analysis Descriptive statistics ... been shown to be valid and internally consistent [6] The purpose of this study was to translate IKHOAM into Hausa language and to investigate its validity and internal consistency This would hopefully...
- 5
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008