Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx

Eur J Biochem 269, 2516–2526 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02916.x A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor Michael Hortner1,2, Ulrich Nielsch1, Lorenz M Mayr3, Peter C Heinrich2 and Serge Haan2 ă Bayer Pharma Research Center, Wuppertal, Germany; 2Institut fuăr Biochemie, Rheinisch-Westfaălische Technische Hochschule Aachen, Germany; 3Novartis Pharma, Basel, Switzerland Erythropoietin (Epo) is a hematopoietic cytokine that is crucial for the differentiation and proliferation of erythroid progenitor cells Epo acts on its target cells by inducing homodimerization of the erythropoietin receptor (EpoR), thereby triggering intracellular signaling cascades The EpoR encompasses eight tyrosine motifs on its cytoplasmic tail that have been shown to recruit a number of regulatory proteins Recently, the feedback inhibitor suppressor of cytokine signaling-3 (SOCS-3), also referred to as cytokineinducible SH2-containing protein (CIS-3), has been shown to act on Epo signaling by both binding to the EpoR and the EpoR-associated Janus kinase (Jak2) [Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I & Yoshimura, A (2000) J Biol Chem 275, 29338–29347] In this study tyrosine 401 was identified as a binding site for SOCS-3 on the EpoR Here we show that human SOCS-3 binds to pY401 with a Kd of 9.5 lM while another EpoR tyrosine motif, pY429pY431, can also interact with SOCS-3 but with a ninefold higher affinity than we found for the previously reported motif pY401 In addition, SOCS-3 binds the double phosphorylated motif pY429pY431 more potently than the respective singly phosphorylated tyrosines indicating a synergistic effect of these two tyrosine residues with respect to SOCS-3 binding Surface plasmon resonance analysis, together with peptide precipitation assays and model structures of the SH2 domain of SOCS-3 complexed with EpoR peptides, provide evidence for pY429pY431 being a new high affinity binding site for SOCS-3 on the EpoR Cytokines play an important role in cellular events such as differentiation and growth of the cells in the immune and hematopoietic systems Erythropoietin (Epo) [1], a 30-kDa glycoprotein hormone synthesized by the kidney in response to tissue hypoxia [2], is crucial for the survival, proliferation and differentiation of erythroid precursor cells It acts on target cells by inducing homodimerization of its specific cell surface receptor The erythropoietin receptor (EpoR) is a member of the cytokine receptor superfamily that includes receptors for prolactin, IL-3, granulocyte-colony stimulating factor and thrombopoietin (for a recent review on EpoR signal transduction see [3]) Following ligand binding, the EpoR associated Janus kinase (Jak2) is activated and phosphorylates tyrosine residues within the cytoplasmic region of the receptor The phosphotyrosine motifs act as recruitment sites for cytoplasmic proteins like the signal transducer and activator of transcription (STAT5) STAT5 itself is then phosphorylated, dissociates from the receptor and forms active dimers that translocate into the nucleus where they bind to specific enhancer sequences in the promoters of responsive genes Suppressor of cytokine signaling-3 (SOCS-3), alternatively referred to as cytokine-inducible SH2-containing protein-3 (CIS-3), belongs to the SOCS family of proteins which have been shown to be induced by a number of cytokines and negatively regulate signal transduction in a classical feedback loop [4–7] SOCS-proteins share a central src homology)2 (SH2) domain and a C-terminal motif called the SOCS box [8–10], which is thought to be involved in degradation of the protein by the ubiquitin-proteasome pathway [11,12] The first member of this family, CIS, was cloned as an immediateearly gene induced by several cytokines CIS has been demonstrated to bind to tyrosine-phosphorylated motifs within EpoR and the IL-3 receptor, thereby inhibiting signal transduction [4] Furthermore, CIS was shown to bind to phosphotyrosine pY401 of EpoR and was proposed to inhibit signaling by attenuating the STAT5 response [13,14] In contrast, SOCS-3 was initially reported to inhibit signal transduction by binding to the activation loop of the Janus kinases [15] Meanwhile, it is known that SOCS-3 exerts at least part of its effect by directly binding to activated cytokine receptor subunits such as gp130 and the leptin receptor [16–19] Furthermore it was shown that SOCS-3 concomitantly associates with both the EpoR and Jak2 [20], and in this report the binding motif for SOCS-3 was identified as pY401 of the EpoR In the present study we show that SOCS-3 also binds to another motif within the EpoR, pY429pY431 and this with a ninefold higher affinity than to the previously reported motif encompassing pY401 Additionally we found a higher Correspondence to P C Heinrich, Institut fur Biochemie, Rheinischă Westfalische Technische Hochschule Aachen, Pauwelsstrasse 30, ă D-52074 Aachen, Germany E-mail: heinrich@rwth-aachen.de Abbreviations: CIS, cytokine-inducible SH2-containing protein; Epo, erythropoietin; EpoR, erythropoietin receptor; pY, phospho-tyrosine; IL, interleukin; Jak, Janus kinase; SA, streptavidin; SH2, src-homology 2; SHP, SH2-containing protein-tyrosine phosphatase; SOCS, suppressor of cytokine signaling; SPR, surface plasmon resonance; STAT, signal transducer and activator of transcription; RU, response unit (Received 16 January 2002, revised April 2002, accepted April 2002) Keywords: erythropoietin; SOCS proteins; SH2-domains Ó FEBS 2002 SOCS-3 binds to the pY429pY431 motif of Epo-R (Eur J Biochem 269) 2517 affinity of SOCS-3 for the double-phosphorylated peptide containing both pY429 and pY431 than to the respective single-phosphorylated tyrosine motifs Surface plasmon resonance (SPR) analysis, together with in vitro binding assays and model structures of the SH2 domain of SOCS-3 complexed with EpoR peptides provide evidence for pY429pY431 being a new high affinity binding site for SOCS-3 within the EpoR MATERIALS AND METHODS Materials Biotinylated peptides were purchased from PolyPeptide Laboratories (Munich, Germany) The amino-acid sequences of the peptides are shown in Fig Simian monkey kidney (COS7) cells were purchased from ATCC (Rockville, MD, USA) (CRL 1651) Cell culture media and antibiotics were obtained from Life Technologies (Rockville, MD, USA), and fetal bovine serum from Seromed (Berlin, Germany) Cloning of human SOCS-3 Constructions were carried out using standard procedures [21] Human SOCS-3 cDNA was amplified from EST#725896 (Research Genetics, Huntsville, AL, USA) and cloned into the pET32 vector (pET32-hSOCS-3) Flanking primer sequences for PCR were as follows: 5¢-CCATGGTCACCCACAGCAAGTTT-3¢ and 5¢-TGG ACCAGTACGATGCCCCGCTTTAATGAATTC-3¢ For the expression in COS7 cells, human SOCS-3 cDNA was subcloned into pcDNA3.1 (+) by the use of the BamHI and EcoRI restriction sites (pcDNA3-hSOCS-3) Generation of SOCS-3 mutants SH2 domain mutants of SOCS-3 were generated using the Quikchange mutagenesis kit (Stratagene, Heidelberg, Germany) according to the manufacturer’s recommendations Mutagenesis primers were as follows: 5¢-CTACTGGAGCGCAGTGACCGTCGGCGAGGCG AACCTGCTGC-3¢ (G53V s), 5¢-GCAGCAGGTTCGCC TCGCCGACGGTCACTGCGCTCCAGTAG-3¢ (G53V as), 5¢-GACCGGCGGCGAGGCGAACGCGCTGCTC AGTGCCGAGCCCG-3¢ (L58A s), 5¢-CGGGCTCGGC ACTGAGCAGCGCGTTCGCCTCGCCGCCGGTC-3¢ (L58A as), 85¢-CAGTCTGGGACCAAGAACGCGCGC ATCCAGTGTGAGGGG-3¢ (L93A s), 5¢-CCCCTCACA CTGGATGCGCGCGTTCTTGGTCCCAGACTG-3¢ (L93A as), 5¢-GTCTGGGACCAAGAACCTGGAAAT CCAGTGTGAGGGGGGCAGC-3¢ (R94E s), 5¢-GCTG CCCCCCTCACACTGGATTTCCAGGTTCTTGGTCC CAGAC-3¢ (R94E s) Expression of SOCS-3 in bacteria and eukaryotic cells SOCS-3 was expressed as a thioredoxin fusion protein in BL21(DE3) Escherichia coli (Stratagene, Heidelberg, Germany) Bacteria were grown in Luria–Bertani media containing 100 lgỈmL)1 ampicillin at 37 °C to a D600 of and then induced with mM isopropyl thio-b-D-galactoside Cells were harvested after h of expression, resuspended in 50 mM Tris/HCl, pH 8.0, 10% glycerol, and lysed by sonication SOCS-3 was purified on a HiTrap chelating mL column (Amersham-Pharmacia, Freiburg, Germany) with nickel-iminodiacetic acid as matrix Native eluted SOCS-3 was dialyzed into 50 mM Tris, 10 mM dithiothreitol, pH 8.5 and purified to homogeneity by anion exchange chromatography on a MonoQ column (Amersham–Pharmacia, Freiburg, Germany) For biosensor measurements the protein was dialyzed against 50 mM Tris/HCl, pH 8.0, 10 mM dithiothreitol, 0.05% Chaps Purity of the recombinant protein was monitored by SDS/PAGE COS7 and 293T cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 50 lgỈmL)1 penicillin and 100 lgỈmL)1 streptomycin Approximately 1.5 · 107 cells were transiently transfected with lg pcDNA3-hSOCS-3 by using the fuGENE6 (Roche, Mannheim, Germany) transfection reagent After 12 h the cells were split : and harvested after another 24 h in culture medium Biosensor analysis Fig Schematic representation of the EpoR showing the location of the eight cytoplasmic tyrosine motifs used in this study (A) and the sequence of the peptides used for SPR and precipitation assays (B) Phosphorylation of the tyrosine residue is indicated as (pY), unphosporylated tyrosines as (Y) Biotinylated peptides were loaded on a streptavidin (SA)coated Biosensor chip (Biacore, Freiburg, Germany) The amount of loaded peptide was 80 ± fmolỈmm)2 chip surface which corresponds to 141 ± response units (RUs) Before loading of the sensor chip with peptide the surface was washed three times for 30 s with M NaCl in 50 mM NaOH Peptides (100 ngỈmL)1) were loaded onto the chip up to 150 RUs Protein–peptide interaction were measured by injection of serial dilutions of SOCS-3 over the Ó FEBS 2002 2518 M Hortner et al (Eur J Biochem 269) ă chip surface at a flow rate of 20 lLỈmin)1 for Before injection of SOCS protein, the sensor chip was flushed with bovine serum albumin (0.1 mgỈmL)1) at a flow rate of 20 lLỈmin)1 for For measurement of the Kd value the flow rate was enhanced to 100 lLỈmin)1 in order to obtain higher resolution of kinetics For this type of experiment SOCS-3 was injected for min, dissociation time was min, regeneration of the chip between the measurements in all experiments performed was done at 20 lLỈmin)1 with M NaCl in 50 mM NaOH for 30 s Binding curves were analyzed by using BIAEVALUATION software v3.0.1 (Biacore) To correct for nonspecific binding events, an empty sensor surface without peptide was analyzed in parallel during protein injection Additionally, thioredoxin was injected at high concentrations (3.5 lM) to rule out nonspecific interactions of the fusion protein of SOCS-3 Curves were plotted with subtracted nonspecific binding Determination of the dissociation constant was carried out by Scatchard analysis [22] Peptide precipitation assay and immunoblot analysis Approximately 0.15 lmol of the biotinylated peptides were immobilized by incubation with 2.5 mg NeutrAvidincoupled agarose (Pierce, Bonn, Germany) For SOCS-3 precipitation cells were lysed in 500 lL lysis buffer (50 mM Tris/HCl, pH 8; 150 mM NaCl; 10% glycerol; 0.5% NP-40; 0.1 mM EDTA) supplemented with NaF (50 mM), pepstatin A (2 lgỈmL)1), leupeptin (5 lgỈmL)1), aprotinin (5 lgỈmL)1), phenylmethanesulfonyl fluoride (1 mM) and Na3VO4 (1 mM) Equal amounts of cellular protein and expressed SOCS-3 in each sample were obtained by mixing the total cell lysates prior to the precipitation experiment SOCS-3 was precipitated by incubation of the total cell lysates with the immobilized peptides at °C overnight Precipitates were then washed three times with 500 lL lysis buffer The precipitated proteins were resolved by SDS/ PAGE and transferred to an Immobilon poly(vinylidene difluoride) membrane (Millipore, Eschborn, Germany) using a semidry electroblotting apparatus Human SOCS3 was detected with a polyclonal antibody kindly provided by J A Johnston (Queen’s University, Belfast, Northern Ireland) A polyclonal goat anti-rabbit horse-radish peroxidase-conjugated secondary Ig (DAKO, Hamburg, Germany) was used to visualize the immunoreactive bands by ECL techniques Molecular modeling of the human SOCS-3 SH2 Domain For molecular modeling and graphic representation of the protein structures, the programs WHATIF [23] and GRASP [24] were used on an Indigo2 SGI computer Energy minimizations were performed under vacuum conditions with the GROMOS program library (W F van Gunsteren, distributed by BIOMOS Biomolecular Software B.V., Laboratory of Physical Chemistry, University of Groningen, the Netherlands) The following SH2 domain sequences and structures were used as templates: human c-src protein-tyrosine kinase, Brookhaven data bank entry codes 1hcs, 1a1b and 1shd [25–27]; human phosphatidylinositol 3-kinase p85 subunit, code 1pic [28], bovine phospholipase C-c1, code 2pld [29]; human Bcr-abl protein-tyrosine kinase, code 2abl [30]; murine SHP2 protein-tyrosine phosphatase, accession no 1AYA [31] Initial amino-acid sequence alignments were performed by the use of the BLAST programme [32] Modifications were then introduced to meet structural requirements derived from the known SH2 structures The sequential alignment of the known structures is based on the direct superposition of their backbone coordinates RESULTS SOCS-3 binds to the phosphotyrosine motifs pY343, pY401 and pY429pY431 of the EPO-receptor We and others have recently shown that SOCS-3 exerts its inhibitory activity on IL-6 signaling by binding to phosphotyrosine 759 of gp130 [16,17], which is also the recruitment site for the phosphotyrosine phosphatase SHP2 [33] Moreover, it has been shown that SOCS-3 also binds to the recruitment site for SHP2 of the erythropoetin receptor [20] To determine the binding affinities of SOCS-3 to the EpoR we investigated SOCS-3 binding to tyrosinephosphorylated and nonphosphorylated peptides of all EpoR tyrosine motifs Figure shows the sequences of the peptides used in this study Peptides with two proximate tyrosine residues were presented as double-phosphorylated or mutually substituted with phenylalanine to check synergistic effects on SOCS-3 binding The N-terminal biotinylated peptides were captured on a SA Biosensor chip and the interaction with SOCS-3 was analyzed As control, binding of SOCS-3 to an unloaded sensor surface was measured in parallel Additionally, in all experiments 3.5 lM thioredoxin was injected to rule out nonspecific binding of the fusion protein As shown in Fig 2, we confirmed the binding of SOCS-3 to phosphotyrosine pY401 recently reported by Sasaki et al [20] We also found that SOCS-3 weakly binds to a peptide containing pY343, a binding site for STAT5 [34] Interestingly, SOCS-3 showed high affinity binding to a phosphopeptide encompassing pY429 and pY431 of the EpoR (Fig 2A) Both tyrosines Y429 and Y431 are phosphorylated after stimulation with Epo [34] The interaction between SOCS-3 and this peptide is phosphorylation-dependent as a nonphosphorylated peptide Y429Y431 failed to recruit SOCS-3 (Fig 2A) When either of these two tyrosines were substituted with phenylalanine SOCS-3 binding was significantly reduced (Table 1) Apart from the peptides pY343, pY401 and pY429pY431 none of the other EpoR-tyrosine motifs showed binding to SOCS-3 (data not shown) SOCS-3 binds with higher affinity to pY429 pY431 than to pY401 As SOCS-3 was recruited by both pY401 and pY429pY431 we determined the affinities of the binding of SOCS-3 to these receptor motifs We found that SOCS-3 binds with ninefold higher affinity to pY429pY431, which contained two proximate phosphotyrosines, than to pY401, which had a single phosphotyrosine residue (Table 1) Figure 2B illustrates the concentration dependent binding of human SOCS-3 to immobilized pY401 peptide in the range of 0.275–8.8 lM In Fig 3A and B, Scatchard plots used to assess the binding affinity of SOCS-3 to the pY401 and Ó FEBS 2002 SOCS-3 binds to the pY429pY431 motif of Epo-R (Eur J Biochem 269) 2519 SOCS-3 needs a double phosphorylated Y429Y431 motif for highest affinity binding The motif pY429pY431 of the EpoR contains two tyrosine phosphorylation sites, spaced only by one amino-acid residue (Fig 1) In order to differentiate between these two tyrosines in the context of SOCS-binding we determined binding affinities of SOCS-3 to peptides containing only phosphotyrosine pY429 or pY431, as well as a doublephosphorylated peptide pY429pY431 The SPR measurements demonstrated that highest affinity binding of SOCS-3 occurred only if both tyrosine 429 and tyrosine 431 were phosphorylated (Fig 3B–D and Table 1) SOCS-3 specifically binds to the receptor motifs encompassing tyrosines pY401 and pY429pY431 in COS7 cells Fig Comparison of SOCS-3 binding to pY343, pY401 and pY429pY431 of the human EpoR (A) and sensogram showing the interaction of serial dilutions of SOCS-3 and peptide pY401 (B) (A) Biotinylated peptides were immobilized on SA chips, the concentration of SOCS-3 was 8.8 lM (B) SOCS-3 was diluted twofold from 8.8 lM to 275 nM Purified thioredoxin was taken as control for specific binding Steady state binding values were taken for Scatchardanalysis for the determination of Kd values Table Calculated Kd values of the EpoR peptides as determined by Scatchard analysis ND, not determined due to a lack of interaction with SOCS-3 Peptide Kd (lM) pY343 pY401 pY429pY431 F429pY431 pY429F431 Y429Y431 pY443 pY461pY464 Y461pY464 pY461Y464 pY479 > 30 9.5 ± 1.1 ± 4.6 ± 4.9 ± ND ND ND ND ND ND 0.12 0.03 0.02 0.02 pY429pY431 motifs are shown Scatchard analysis revealed that the dissociation constant Kd is around 9.5 lM for the binding of SOCS-3 to pY401 whereas the pY429pY431 motif bound with a Kd of 1.1 lM (Table 1) In order to investigate whether SOCS-3 binds to the receptor motifs containing pY401 and pY429pY431, we performed a peptide precipitation assay with the biotinylated EpoR-peptides, which have been shown to interact with SOCS-3 in the SPR experiments The nonphosphorylated peptide Y429Y431 was used as control Equal amounts of whole cell extracts of COS7 cells expressing SOCS-3 were incubated with the different EpoR-peptides immobilized on NeutrAvidin-coupled agarose Subsequently, precipitated SOCS-3 was analyzed by Western blotting (Fig 4) SOCS-3 was found to specifically interact with the tyrosine motifs pY401 and pY429pY431 pY429pY431 was more potently recruiting SOCS-3 than pY401, reflecting the high affinity binding determined by SPR The nonphosphorylated peptide Y429Y431 failed to precipitate SOCS-3 as did the phosphopeptide containing pY343 of the EpoR This shows that the interaction is phosphorylation- and sequence-dependent Single phosphorylated peptides of the motif encompassing tyrosines Y429 and Y431 in which one of the tyrosines has been exchanged to phenylalanine (pY429F431 and F429pY431) also readily precipitated SOCS-3, although to a lesser extent than the double phosphorylated peptide The single phosphorylated peptides were found to precipitate SOCS-3 with similar efficiency The peptide precipitation assay suggests that both phosphotyrosines take part in the interaction with SOCS-3 and act synergistically Model structure of the human SOCS-3 SH2 domain To understand the binding of the different receptor peptides to the SOCS-3 SH2 domain at the molecular level and to explain the distinct binding affinities, we generated a model structure of the human SOCS-3 SH2 domain based on solved structures of other SH2 domains Figure shows an alignment of the SOCS-3 SH2 domain with the sequences of the template structures that were used for model building The sequence similarity between the SOCS-3 SH2 domain and the aligned SH2 domains varies between 37 and 41% and reflects the sequence similarity between the structurally characterized SH2 domains like Src and SHP2 (40%) or Src and PLCc (39%) for example For evaluation of the binding specificities of the SOCS-3 SH2 domain, we modelled the complex of the SOCS-3 SH2 domain and the receptor peptides pY401 and pY429pY431 (Fig 6) For comparison, 2520 M Hortner et al (Eur J Biochem 269) ă ể FEBS 2002 Fig Scatchard analysis of SOCS-3 interaction with EpoR peptides pY401 (A), pY429pY431 (B), pY429F431 (C), and F429pY431 (D) Plateau values of the binding curves with serial dilutions of SOCS-3 (30, 15, 7.5, 3.75, 1.9 and 0.9 lM) were taken for calculation of the Kd values Fig SOCS-3 selectively binds to tyrosine-phosphorylated peptides corresponding to the pY401 and pY429pY431 motifs of EpoR COS7 cells were transfected with an expression vector for human SOCS-3 (5 lg) Thirty-six hours after transfection cellular extracts were prepared and incubated with biotinylated peptides corresponding to the EpoR motifs encompassing Y343, Y401 and Y429Y431 immobilized on NeutrAvidin-coupled agarose After precipitation the proteins were subjected to Western blot analysis using a polyclonal anti-(SOCS-3) Ig to detect coprecipitated SOCS-3 we also considered the binding of the receptor peptide corresponding to the SOCS-3 recruitment site pY759 of gp130 Figure 6A shows the binding of the SOCS-3 SH2 domain to the peptide pY401 (SFEpYTILDPSS; rod model) The SOCS-3 SH2 domain is represented as electrostatic potential map The phosphotyrosine pY401 is embedded in the positively charged binding pocket (blue) of the SH2 domain containing R71 of SOCS-3 In the model structure, phenylalanine at position Y)2 of the peptide contacts G53 Threonine Y+1 can undergo a hydrophobic contact with bC of K91 as well as a hydrogen bond with the backbone NH-group of asparagine N92 The leucine residue at position Y+3 inserts into a hydrophobic pocket made up of tyrosine Y127, leucines L93 and L104 and phenylalanine F136 Furthermore, the proline at position Y+5 is in close proximity to P108 of SOCS-3 Thus the model suggests that the major contributions to the specific binding of SOCS-3 to pY401 originate from amino-acid residues at the positions Y)2, Y+1 and Y+3 SOCS-3 binding to the peptide pY429pY431 is represented in Fig 6B The predicted contacts within the SH2 domain for the residues at positions Y)2 (L) and Y+3 (L) of the peptide are similar to pY401 The leucine at Y+1 is predicted to undergo a hydrophobic contact with the side chain of K91 In addition, the valine residues at positions Y+4 and Y+5 contact F136 and P108, respectively The Y+2 residue in SH2/peptide interactions is usually exposed to the solvent and does not contribute to the binding [35–37] Most interestingly, in our model the phosphotyrosine at Y+2 is able to form a salt bridge with the positively charged R94 (contact is shown by a red Ô±Õ symbol in Fig 6B) This explains our observation that the double phosphorylated peptide pY429pY431 binds with higher affinity than a peptide in which pY431 is substituted by phenylalanine In addition the side chain of R94 is able to build up a hydrophobic contact with the aromatic ring of the phosphotyrosine at position Y+0 (contact shown as a red ÔhÕ in Fig 6B) Taken together, the contributions of the positions Y+2, Y+4 and Y+5 appear to account for most Ó FEBS 2002 SOCS-3 binds to the pY429pY431 motif of Epo-R (Eur J Biochem 269) 2521 Fig Alignment of the SOCS-3 SH2 domain with other SH2 domains The sequence of the human SOCS-3 SH2 domain was aligned with the SH2 domains of the human c-src protein-tyrosine kinase [25–27], the human phosphatidylinositol 3-kinase p85 subunit [28], the bovine phospholipase C-c [29], the human Bcr-abl protein-tyrosine [30] as well as with the N-terminal SH2 domains of murine SHP1 and SHP2 protein-tyrosine phosphatases [31,50] Secondary structure characteristics are given on top following the common nomenclature [37] SOCS-3 amino-acid numbers (italic) precede the sequence The sequence homology (%) between the SOCS-3 SH2 domain and the aligned sequences is indicated in parentheses Residues that are highly conserved within the represented sequences are highlighted (bold characters) Blue and red characters indicate residues conserved in SH2 domains to at least 30% or 80%, respectively (software: MULTALIN v5.4.1 [51]) Residues interacting with the phosphotyrosine as suggested by the model structure are represented by closed circles The open arrowhead highlights the amino acid in the aA helix that contacts the residue Y)2 The amino acids postulated to interact with the peptide residues Y+1, Y+2, Y+3 Y+4 and Y+5 are indicated by the numbers 1, 2, 3, and 5, respectively of the higher affinity of pY429pY431 to SOCS-3 in comparison to the peptide pY401 The SOCS-3 residues important for the binding of the different peptide residues are highlighted in Fig 6A As we and others have recently shown that SOCS-3 binds to gp130 through its SH2 domain [16,17], we have also modeled a peptide encompassing the phosphotyrosine 759 of gp130 to the SOCS-3 SH2 domain (Fig 6C) The model suggests that this peptide binds in a way very similar to pY429pY431 with the residues Y)2, Y+3, Y+4 and Y+5 building up hydrophobic contacts to the SOCS-3 SH2 domain Serine at position Y+1 forms a hydrogen bond with the backbone of asparagine N92 In order to check the reliability of our model structure we generated several point mutations within the SOCS-3 SH2 domain and performed a peptide precipitation assay using the phosphorylated peptides pY429pY431, pY429F431 and F429pY431 (Fig 7) Total cell lysates (TCL) of 293T cells expressing wild-type SOCS-3 or SOCS-3 mutants (R94E, L93A, L58A and G53V) were incubated with the biotinylated peptide pY429pY431 immobilized on NeutrAvidincoupled agarose Subsequently, precipitated SOCS-3 was analyzed by Western blotting Figure 7A shows that the SOCS-3 mutant L58A, which we predicted not to affect peptide binding, can be precipitated with pY429pY431 to the same extent as wild-type SOCS-3 The point mutations R94E, L93A and G53V that we expected to play a role in peptide recognition all impair SOCS-3 precipitation with R94E and G53V most strongly affecting the interaction between SOCS-3 and pY429pY431 (Fig 7A) To better assess the binding mode of the peptides pY429pY431, pY429F431 or F429pY431, we performed a peptide precipitation assay with wild-type SOCS-3 or the SOCS-3 R94E mutant (Fig 7B) Again we find that the mutation of arginine 94 to glutamic acid strongly affects the interaction of SOCS-3 with the double phosphorylated peptide pY429pY431 (pYpY) In comparison, the mutation only marginally reduces the interaction with the single phosphorylated peptides pY429F431 (pYF) and F429pY431 (FpY) suggesting that both phosphotyrosines bind to the phosphotyrosine binding pocket of the SH2 domain, with R94 only playing a minor role in the binding of these peptides DISCUSSION The cytoplasmic part of the EpoR contains eight tyrosine residues that serve as recruitment sites for a number of SH2 domain containing proteins Among these are the proteintyrosine phosphatases SHP1 and SHP2 [38,39], the Jak2 and PI3 kinases [40,41] as well as STAT5, CIS and SOCS-3 [4,20,42] In order to study binding of SOCS-3 to the EpoR we used a biochemical approach by means of SPR measurements For this purpose, tyrosine phosphorylated and nonphosphorylated peptides of all eight tyrosine motifs of the human EpoR were immobilized on a sensor chip and the interaction with SOCS-3 was analyzed To further validate the SPR data obtained, in vitro binding assays in eukaryotic cells were performed The results from our SPR experiments show that SOCS-3 binds to pY343, pY401 and pY429pY431 with different affinities (Table 1) The phosphotyrosine peptides of all other EpoR tyrosine motifs did not show significant binding to SOCS-3 In the SPR experiments the weakest interaction of SOCS-3 was observed with peptide pY343, a motif that has been shown to recruit STAT5 [41] The dissociation constant for this binding event was greater than 30 lM In this case the exact Kd value was not assessed by Scatchard analysis because the highest SOCS-3 concentration was 30 lM and a calculation by the BIAEVALUATION software 2522 M Hortner et al (Eur J Biochem 269) ă ể FEBS 2002 Fig The SOCS-3 point mutations G53V, L93A and R94E affect the binding to phosphotyrosine peptides 293T cells were transfected with an expression vector for wild-type SOCS-3 or SOCS-3 mutants (5 lg) 36 h after transfection cellular extracts were prepared and incubated with biotinylated peptides immobilized on NeutrAvidin-coupled agarose After precipitation the proteins were subjected to Western blot analysis using a polyclonal SOCS-3 antibody to detect coprecipitated SOCS-3 Detection of total cell lysates (TCL) with a SOCS-3 antibody was used to check the expression levels of the different mutants (A) Precipitation of SOCS-3 WT or the SOCS-3 point mutations G53V, L58A, L93A and R94E with the peptide pY429pY431 (pYpY) (B) Precipitation of SOCS-3 WT or SOCS-3 R94E with the peptides pY429pY431 (pYpY), pY429F431 (pYF) and F429pY431 (FpY) Fig Model structure of the SOCS-3 SH2 complexed with phosphotyrosine peptides Electrostatic potential maps of the model structure of the human SOCS-3 SH2 domain complexed with peptides corresponding to the pY401 and the pY429pY431 motifs of the EpoR as well as the pY759 motif of gp130 Red and blue-coloured regions on the structure surface of the SH2 domain indicate negative and positive charges, respectively Bound phosphopeptides are represented as rod models with nitrogen, oxygen, carbon, and phosphorous atoms being coloured in blue, red, white, and yellow, respectively The N- and C-termini of the bound peptides are indicated in italic (A) Interaction of the SOCS-3 SH2 domain with the SFE(pY401)TILDPSS motif of EpoR (B) with the EpoR motif HLK(pY429)L(pY431)LVVSS and (C) with the TVQ(pY759)STVVHSG motif of gp130 The positions of the amino acids of SOCS-3 relevant for the interaction with the peptide is indicated The hydrophobic contact (h) between the side chain of R94 and pY429 as well as the salt bridge (±) between R94 and pY431 are highlighted in red was not possible because the sensograms could not be fitted to an ideal binding model Confirming results were obtained from peptide precipitation assays, as we were not able to precipitate SOCS-3 out of COS7 cells overexpressing human SOCS-3 (Fig 4) This indicates that the pY343 motif does not play a role with respect to SOCS-3 recruitment In the context of IL-6 signaling, SOCS-3 has been found to act as potential competitor to SHP2 for the binding of the same tyrosine Y759 in the gp130 receptor subunit [16,17] Additionally, it was recently shown that the binding site of SHP2 in the EpoR, Y401 also recruits SOCS-3, which results in the down-regulation of the Epo signaling [20] In our experiments, we confirm binding of SOCS-3 to pY401, with a calculated Kd for this interaction in the range of 9.5 lM (Table 1) Concerning EpoR signaling, SHP2 is suggested to positively regulate proliferation [43] As we found that SOCS-3 binds to the same phosphotyrosine of gp130 as SHP2, which negatively regulates IL-6 signaling [16], we asked whether SOCS-3 would likewise compete with another negative regulator in the EpoR context, namely SHP1 SHP1 is closely related to SHP2 and is recruited to the pY429pY431 motif of the EpoR after stimulation, whereas pY429 is the higher affinity binding site for the phosphatase [38] Both pY429 and pY431 are phosphorylated after stimulation with Epo [34] Ó FEBS 2002 SOCS-3 binds to the pY429pY431 motif of Epo-R (Eur J Biochem 269) 2523 In Epo signal transduction, SHP1 has been reported to negatively regulate proliferation and differentiation of Ba/F3 or SKT6 cells [38,44] Interestingly, we found a peptide encompassing the double phosphorylated tyrosine motif pY429pY431 to bind SOCS-3 with a Kd of 1.1 lM, a ninefold higher affinity than determined for pY401 Single phosphorylated peptides pY429 and pY431 revealed Kd values in the range of lM We were able to confirm this finding by the use of a peptide precipitation assay SOCS-3 was coprecipitated with both the double phosphorylated peptide pY429pY431 as well as the single phosphorylated motifs, with pY429pY431 precipitating SOCS-3 most potently (Fig 4) As the proximity of pY431 to pY429 impedes the simultaneous recruitment of two SOCS-3 SH2 domains to this double tyrosine motif, the two phosphotyrosine residues must contact the same SH2 domain, thereby both contributing to the high affinity binding In order to better evaluate the results obtained in the SPR experiments and the peptide precipitation assay, we generated a model structure of the human SOCS-3 SH2 domain complexed with peptides corresponding to the receptor motifs pY401 and pY429pY431 of the EpoR as well as to the SOCS-3 recruiting motif pY759 of gp130 (Fig 6) Critical positions for specific binding of SH2 domains to phosphotyrosine motifs are the amino acids surrounding the phosphotyrosine residues The C-terminal amino-acid residues at positions Y+1 to Y+5 of bound peptides have been shown to be important for the interaction with SH2 domains, with positions Y+1 and Y+3 having the greatest impact on the binding [35,37] Table shows the sequences of several receptor phosphotyrosine motifs that have been shown to bind SOCS-3 [16–20] (and this study) Based on the model structure, we determined the residues involved in specific binding to the SOCS-3 SH2 domain (Table 2) Positions Y)2, Y+1, Y+3, Y+4 as well as Y+5 all contribute to the interaction with residues Y)2, Y+1 and Y+3 being most crucial for specific binding This is supported by a recent report investigating the binding of SOCS-3 to the gp130 tyrosine motif pY759 where these amino-acid residues have also been found to contribute to the specific recruitment of SOCS-3 [17] In regard to the overlapping binding specificities of SOCS-3 and the two phosphatases SHP1 and SHP2, the position Y)2 of the interacting phosphotyrosine motif seems to play an importTable Sequence comparison of receptor phosphotyrosine motifs known to recruit SOCS-3 Bold characters highlight residues favourable for selective binding to the SOCS-3 SH2 domain h, hydrophobic residue Receptor pY location sequence h-gp130 h-EpoR h-EpoR m-LeptinR m-LeptinR Consensus sequence pY759 pY401 pY429 pY985 pY1077 S T A S P H P S K S V F L V V h Q E K K C X pY pY pY pY pY pY S T V V H T I L D P L pY L V V A T L V S L G V T S h X L h h S V T Position relative to pY )2 +1 +2 +3+4+5 S G S S S D N D V N ant role Although the two phosphatases bind to different tyrosine motifs within the EpoR, they are recruited to the same phosphotyrosine pY612 of the common b chain in the context of IL-3 signaling [45] A common feature of SHP1 and SHP2 recruiting motifs is a hydrophobic residue at position Y)2 of the binding phosphotyrosine sequence It has been shown that this residue is filling a gap created by a glycine in helix aA within the SH2 domain of the phosphatase [31,46–48] The glycine is conserved in the N- and C-terminal SH2 domains of both SHP1 and SHP2 and is required for the unusual involvement of the residue Y)2 of the binding phosphotyrosine motif [47] Most interestingly, the glycine residue in helix aA of the SH2 domain is conserved in SOCS-3 and has recently been shown to contribute to the binding of SOCS-3 to gp130 [17] As illustrated in Table 2, all receptor tyrosine motifs that have been shown to bind SOCS-3 contain a hydrophobic residue at position Y)2 The model structure of the SOCS-3 SH2 domain shows that this residue can easily be fitted into a gap created by G53 of SOCS-3 In regard to the position Y+1 of the interacting motifs, we suggest a hydrophobic residue contacting the side chain of K91 or alternatively a small polar residue like serine or threonine making a hydrogen bond with the backbone of the b strand D to be most favourable for peptide recognition For the positions Y+3 to Y+5, a hydrophobic residue seems optimal for SOCS-3 recruitment with Y+3 contributing most to high affinity binding In order to check the reliability of our model structure we generated several point mutations within the SH2 domain of SOCS-3 We mutated L58, which we predicted not to be involved in peptide binding, as well as the residues G53, L93 and R94, which according to our model contact the peptide positions Y)2, Y+3 and Y+2, respectively A peptide precipitation assay confirms the reliability of our model structure (Fig 7) Whereas L58A does not affect peptide binding, the point mutation G53V strongly impairs the interaction between SOCS-3 and the peptide According to our model structure the valine prevents optimal binding of the peptide by sterically interfering with the hydrophobic residue at position Y)2 of the phosphotyrosine peptide L93 is part of a hydrophobic pocket also involving Y127, L104 and F136 that accommodates the peptide position Y+3 The fact that the mutation of leucine 93 to alanine reduces the interaction with pY429pY431 further confirms our model structure We propose arginine 94 to provide a double contact with the peptide pY429pY431 First, the side chain makes a hydrophobic contact with the aromatic ring of pY429 (contact shown as a red ÔhÕ in Fig 6B) and thereby contributes to the binding of pY429 into the phosphotyrosine binding pocket of the SH2 domain This interaction is likely to occur for every phosphotyrosine that is embedded in the classical phosphotyrosine binding pocket of the SOCS-3 SH2 domain and can also be found in other SH2 domains as demonstrated by the solved structures of Src [25] and SHP2 [31], for example Second, we postulate the positively charged R94 to form a salt bridge with the negatively charged phosphotyrosine at position Y+2 of the pY429pY431 motif (contact shown as red Ô±Õ in Fig 6B) The point mutation R94E (which should only marginally affect the interaction ÔhÕ but would impede the contact Ô±Õ) drastically affected SOCS-3 binding to the double phosphorylated peptide pY429pY431 in our peptide Ó FEBS 2002 2524 M Hortner et al (Eur J Biochem 269) ă precipitation assay (Fig 7A,B) In contrast the binding of the single phosphorylated peptides pY429F431 and F429pY431 is only weakly affected by the mutation of arginine 94 to glutamic acid (Fig 7B) This indicates that for both peptides the phosphotyrosine residue binds into the classical phosphotyrosine binding pocket The binding of the peptide F429pY431 thus involves a shift of two residues when compared to the binding mode of pY429pY431 with pY431 binding into the classical pY-binding pocket and F429 (position Y)2) filling the gap created by G53 of the SH2 domain In the context of the activated EpoR (and peptide pY429pY431), where both tyrosines are phosphorylated, this binding mode would be unfavourable because of the presence of pY429 at position Y)2 The peptide precipitation assay with the pY429pY431 motif (Fig 7A,B) supports the idea that arginine 94 plays an important role in the recognition of the double phosphorylated motif by forming a salt bridge with phosphotyrosine pY431 Based on the identified binding motifs for SOCS-3 and our model structure, we propose a consensus motif h-X-pY-h/S/ T-X-L/V-h-h (with h ¼ hydrophobic) optimal for SOCS-3 recruitment (see also Table 2) Remarkably, in the case of the EpoR motif pY429pY431, we find pY431 at position Y+2 contributes to SOCS-3 binding Similar co-operative effects of two proximal phosphotyrosine residues have been reported to increase the binding of the platelet-derived growth factor (PDGF) b-receptor to the SH2 domain of the Src family kinases [49] Mori et al found a double phosphorylated tyrosine motif encompassing tyrosines Y579 and Y581 to recruit and activate the kinases of the Src family more potently than the corresponding single phosphorylated motifs The authors discuss the phosphorylation of tyrosine Y581 creating a more favourable conformation of the sequence surrounding the tyrosines Y579 and Y581, thereby increasing binding affinity Interestingly, the EpoR contains a similar phosphotyrosine arrangement pattern The plasmon resonance studies, peptide precipitation assays as well as the model structures presented in this report, suggest that phosphotyrosine pY429 binds into the classical phosphotyrosine binding pocket of the SOCS-3 SH2 domain between helix aA and the central b sheet pY431 appears to increase the binding affinity by providing an additional contact with the SH2 domain of SOCS-3 involving R94 A conformational change induced by the phosphorylation of tyrosine Y431 may also contribute to the increase in binding affinity compared to the single phosphorylated peptide The positively charged residue (R94 in SOCS-3) in b strand D is conserved (R/K) in a large number of SH2 domains As the members of the Src family also carry a positively charged residue at this position, we favour the idea that the enhanced binding of Src family kinases to the pY579pY581 motif of the PDGF b-receptor reported by Mori et al [49] may be due to the formation of a salt bridge between pY581 and the lysine residue in b strand D of the SH2 domain of the Src kinases The co-operative binding mode that we describe may thus represent a more general binding mechanism by which SH2 domains achieve high affinity binding to motifs with proximal phosphotyrosine residues Our data strongly suggest that SOCS-3 binds to more than one binding site to the EpoR As shown by SPR measurements as well as in vitro binding assays the double phosphorylated motif pY429pY431 in the EpoR seems to be the preferred binding site for SOCS-3 The implications of the regulatory proteins SOCS-3, SHP2 and SHP1 sharing recruitment sites on the EpoR will be subject to further investigations ACKNOWLEDGEMENTS We thank Joachim Grotzinger for valuable advice concerning the ă generation of the model structures, James A Johnston for providing the polyclonal SOCS-3 antibody and Fred Schaper for helpful discussions This work was supported by grants from the Deutsche Forschungsgemeinschaft (Bonn, Germany) and the Fonds der Chemischen Industrie (Frankfurt/Main, Germany) REFERENCES Lai, P.H., Everett, R., Wang, F.F., Arakawa, T & Goldwasser, E (1986) Structural characterization of human erythropoietin J Biol Chem 261, 3116–3121 Krantz, S.B (1991) Erythropoietin Blood 77, 419–434 Wojchowski, D.M., Gregory, R.C., Miller, C.P., Pandit, A.K & Pircher, T.J (1999) Signal transduction in the erythropoietin receptor system Exp Cell Res 253, 143–156 Yoshimura, A., Ohkubo, T., Kiguchi, T., Jenkins, N.A., Gilbert, D.J., Copeland, N.G., Hara, T & Miyajima, A (1995) A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin and erythropoietin receptors EMBO J 14, 2816–2826 Starr, R., Willson, T.A., Viney, E.M., Murray, L.J., Rayner, J.R., Jenkins, B.J., Gonda, T.J., Alexander, W.S., Metcalf, D., Nicola, N.A & Hilton, D.J (1997) A family of cytokine-inducible inhibitors of signalling Nature 387, 917–921 Endo, T.A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S & Yoshimura, A (1997) A new protein containing an SH2 domain that inhibits JAK kinases Nature 387, 921–924 Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., Akira, S & Kishimoto, T (1997) Structure and function of a new STAT-induced STAT inhibitor Nature 387, 924–929 Hilton, D.J., Richardson, R.T., Alexander, W.S., Viney, E.M., Willson, T.A., Sprigg, N.S., Starr, R., Nicholson, S.E., Metcalf, D & Nicola, N.A (1998) Twenty proteins containing a C-terminal SOCS box form five structural classes Proc Natl Acad Sci USA 95, 114–119 Masuhara, M., Sakamoto, H., Matsumoto, A., Suzuki, R., Yasukawa, H., Mitsui, K., Wakioka, T., Tanimura, S., Sasaki, A., Misawa, H., Yokouchi, M., Ohtsubo, M & Yoshimura, A (1997) Cloning and characterization of novel CIS family genes Biochem Biophys Res Commun 239, 439–446 10 Minamoto, S., Ikegame, K., Ueno, K., Narazaki, M., Naka, T., Yamamoto, H., Matsumoto, T., Saito, H., Hosoe, S & Kishimoto, T (1997) Cloning and functional analysis of new members of STAT induced STAT inhibitor (SSI) family: SSI-2 and SSI-3 Biochem Biophys Res Commun 237, 79–83 11 Zhang, J.G., Farley, A., Nicholson, S.E., Willson, T.A., Zugaro, L.M., Simpson, R.J., Moritz, R.L., Cary, D., Richardson, R., Hausmann, G., Kile, B.J., Kent, S.B., Alexander, W.S., Metcalf, D., Hilton, D.J., Nicola, N.A & Baca, M (1999) The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation Proc Natl Acad Sci USA 96, 2071–2076 12 Okabe, S., Tauchi, T., Morita, H., Ohashi, H., Yoshimura, A & Ohyashiki, K (1999) Thrombopoietin induces an SH2-containing protein, CIS1, which binds to Mpl: involvement of the ubiquitin proteosome pathway Exp Hematol 27, 1542–1547 Ó FEBS 2002 SOCS-3 binds to the pY429pY431 motif of Epo-R (Eur J Biochem 269) 2525 13 Matsumoto, A., Masuhara, M., Mitsui, K., Yokouchi, M., Ohtsubo, M., Misawa, H., Miyajima, A & Yoshimura, A (1997) CIS, a cytokine inducible SH1 protein, is a target of the JAKSTAT5 pathway and modulates STAT5 activation Blood 89, 3148–3154 14 Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C & Mayeux, P (1998) Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription (STAT5) activation Possible involvement of the ubiquitinated CIS protein J Biol Chem 273, 28185–28190 15 Sasaki, A., Yasukawa, H., Suzuki, A., Kamizono, S., Syoda, T., Kinjyo, I., Sasaki, M., Johnston, J.A & Yoshimura, A (1999) Cytokine-inducible SH2 protein-3 (CIS3/SOCS3) inhibits Janus tyrosine kinase by binding through the N-terminal kinase inhibitory region as well as SH2 domain Genes Cells 4, 339–351 16 Schmitz, J., Weissenbach, M., Haan, S., Heinrich, P.C & Schaper, F (2000) SOCS3 exerts its inhibitory function on interleukin-6 signal transduction through the SHP2 recruitment site of gp130 J Biol Chem 275, 12848–12856 17 Nicholson, S.E., De Souza, D., Fabri, L.J., Corbin, J., Willson, T.A., Zhang, J.G., Silva, A., Asimakis, M., Farley, A., Nash, A.D., Metcalf, D., Hilton, D.J., Nicola, N.A & Baca, M (2000) Suppressor of cytokine signaling-3 preferentially binds to the SHP-2-binding site on the shared cytokine receptor subunit gp130 Proc Natl Acad Sci USA 97, 6493–6498 18 Bjørbaek, C., Lavery, H.J., Bates, S.H., Olson, R.K., Davis, S.M., Flier, J.S & Myers, M.G Jr (2000) SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985 J Biol Chem 275, 40649–40657 19 Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J & Tavernier, J (2000) Identification of the Y985 and Y1077 motifs as SOCS3 recruitment sites in the murine leptin receptor FEBS Lett 486, 33–37 20 Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I & Yoshimura, A (2000) CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2 J Biol Chem 275, 29338–29347 21 Sambrook, J & Russell, D.W (2001) Molecular Cloning: a Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 22 Payne, G., Shoelson, S.E., Gish, G.D., Pawson, T & Walsh, C.T (1993) Kinetics of p56lck and p60src Src homology domain binding to tyrosine-phosphorylated peptides determined by a competition assay or surface plasmon resonance Proc Natl Acad Sci USA 90, 4902–4906 23 Vriend, G (1990) WHAT IF: a molecular modeling and drug design program J Mol Graph 8, 52–56 24 Nicholls, A., Sharp, K.A & Honig, B (1991) Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons Proteins 11, 281–293 25 Xu, R.X., Word, J.M., Davis, D.G., Rink, M.J., Willard, D.H.J & Gampe, R.T.J (1995) Solution structure of the human pp60csrc SH2 domain complexed with a phosphorylated tyrosine pentapeptide Biochemistry 34, 2107–2121 26 Charifson, P.S., Shewchuk, L.M., Rocque, W., Hummel, C.W., Jordan, S.R., Mohr, C., Pacovsky, G.J., Peel, M.R., Rordriguez, M., Sternbach, D.D & Consler, T.G (1997) Peptide ligands of PP60 (C-SRC) SH2 domains: a thermodynamic and structural study Biochemistry 36, 6283 27 Gilmer, T., Rodriguez, M., Jordan, S., Crosby, R., Alligood, K., Green, M., Kimery, M., Wagner, C., Kinder, D & Charifson, P (1994) Peptide inhibitors of src SH3–SH2–phosphoprotein interactions J Biol Chem 269, 31711–31719 28 Breeze, A.L., Kara, B.V., Barratt, D.G., Anderson, M., Smith, J.C., Luke, R.W., Best, J.R & Cartlidge, S.A (1996) Structure of a specific peptide complex of the carboxy-terminal SH2 domain 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 from the p85 alpha subunit of phosphatidylinositol 3-kinase EMBO J 15, 3579–3589 Pascal, S.M., Singer, A.U., Gish, G., Yamazaki, T., Shoelson, S.E., Pawson, T., Kay, L.E & Forman-Kay, J.D (1994) Nuclear magnetic resonance structure of an SH2 domain of phospholipase C-gamma complexed with a high affinity binding peptide Cell 77, 461–472 Nam, H.J., Haser, W.G., Roberts, T.M & Frederick, C.A (1996) Intramolecular interactions of the regulatory domains of the BcrAbl kinase reveal a novel control mechanism Structure 4, 1105– 1114 Lee, C.-H., Kominos, D., Jacques, S., Margolis, B., Schlessinger, J., Shoelson, S.E & Kuriyan, J (1994) Crystal structures of peptide complexes of the amino-terminal SH2 domain of the SYP tyrosine phosphatase Structure 2, 423 Altschul, S.F., Gish, W., Miller, W., Myers, E.W & Lipman, D.J (1990) Basic local alignment search tool J Mol Biol 215, 403–410 Fuhrer, D.K., Feng, G.S & Yang, Y.C (1995) Syp associates with gp130 and Janus kinase in response to interleukin-11 in 3T3-L1 mouse preadipocytes J Biol Chem 270, 24826–24830 Klingmuller, U., Bergelson, S., Hsiao, J.G & Lodish, H.F (1996) ă Multiple tyrosine residues in the cytosolic domain of the erythropoietin receptor promote activation of STAT5 Proc Natl Acad Sci USA 93, 8324–8328 Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R.J et al (1993) SH2 domains recognize specific phosphopeptide sequences Cell 72, 767–778 Songyang, Z., Shoelson, S.E., McGlade, J., Olivier, P., Pawson, T., Bustelo, X.R., Barbacid, M., Sabe, H., Hanafusa, H & Yi, T (1994) Specific motifs recognized by the SH2 domains of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk, and Vav Mol Cell Biol 14, 2777–2785 Eck, M.J., Shoelson, S.E & Harrison, S.C (1993) Recognition of a high-affinity phosphotyrosyl peptide by the Src homology-2 domain of p56lck Nature 362, 87–91 Klingmuller, U., Lorenz, U., Cantley, L.C., Neel, B.G & Lodish, ă H.F (1995) Specic recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals Cell 80, 729–738 Tauchi, T., Feng, G.S., Shen, R., Hoatlin, M., Bagby, G.C Jr, Kabat, D., Lu, L & Broxmeyer, H.E (1995) Involvement of SH2containing phosphotyrosine phosphatase Syp in erythropoietin receptor signal transduction pathways J Biol Chem 270, 5631– 5635 Witthuhn, B.A., Quelle, F.W., Silvennoinen, O., Yi, T., Tang, B., Miura, O & Ihle, J.N (1993) JAK2 associates with the erythropoietin receptor and is tyrosine phosphorylated and activated following stimulation with erythropoietin Cell 74, 227–236 Damen, J.E., Cutler, R.L., Jiao, H., Yi, T & Krystal, G (1995) Phosphorylation of tyrosine 503 in the erythropoietin receptor (EpR) is essential for binding the P85 subunit of phosphatidylinositol (PI) 3-kinase and for EpR-associated PI 3-kinase activity J Biol Chem 270, 23402–23408 Damen,J.E.,Wakao,H.,Miyajima,A.,Krosl,J.,Humphries,R.K., Cutler, R.L & Krystal, G (1995) Tyrosine 343 in the erythropoietin receptor positively regulates erythropoietin-induced cell proliferation and Stat5 activation EMBO J 14, 5557–5568 Tauchi, T., Damen, J.E., Toyama, K., Feng, G.S., Broxmeyer, H.E & Krystal, G (1996) Tyrosine 425 within the activated erythropoietin receptor binds Syp, reduces the erythropoietin required for Syp tyrosine phosphorylation, and promotes mitogenesis Blood 87, 4495–4501 Sharlow, E.R., Pacifici, R., Crouse, J., Batac, J., Todokoro, K & Wojchowski, D.M (1997) Hematopoietic cell phosphatase negatively regulates erythropoietin-induced hemoglobinization in erythroleukemic SKT6 cells Blood 90, 2175–2187 2526 M Hortner et al (Eur J Biochem 269) ă 45 Bone, H., Dechert, U., Jirik, F., Schrader, J.W & Welham, M.J (1997) SHP1 and SHP2 protein-tyrosine phosphatases associate with bc after interleukin-3-induced receptor tyrosine phosphorylation Identification of potential binding sites and substrates J Biol Chem 272, 14470–14476 46 Huyer, G., Li, Z.M., Adam, M., Huckle, W.R & Ramachandran, C (1995) Direct determination of the sequence recognition requirements of the SH2 domains of SH-PTP2 Biochemistry 34, 1040–1049 47 Huyer, G & Ramachandran, C (1998) The specificity of the N-terminal SH2 domain of SHP-2 is modified by a single point mutation Biochemistry 37, 2741–2747 48 Beebe, K.D., Wang, P., Arabaci, G & Pei, D (2000) Determination of the binding specificity of the SH2 domains of protein Ó FEBS 2002 tyrosine phosphatase SHP-1 through the screening of a combinatorial phosphotyrosyl peptide library Biochemistry 39, 13251– 13260 49 Mori, S., Ronnstrand, L., Yokote, K., Engstrom, A., Courtneidge, S.A., Claesson-Welsh, L & Heldin, C.H (1993) Identification of two juxtamembrane autophosphorylation sites in the PDGF beta-receptor; involvement in the interaction with Src family tyrosine kinases EMBO J 12, 2257–2264 50 Plutzky, J., Neel, B.G & Rosenberg, R.D (1992) Isolation of a src homology 2-containing tyrosine phosphatase Proc Natl Acad Sci USA 89, 1123–1127 51 Corpet, F (1988) Multiple sequence alignment with hierarchical clustering Nucleic Acids Res 16, 10881–10890  ... this binding event was greater than 30 lM In this case the exact Kd value was not assessed by Scatchard analysis because the highest SOCS-3 concentration was 30 lM and a calculation by the BIAEVALUATION... affinity by providing an additional contact with the SH2 domain of SOCS-3 involving R94 A conformational change induced by the phosphorylation of tyrosine Y4 31 may also contribute to the increase... motifs The authors discuss the phosphorylation of tyrosine Y5 81 creating a more favourable conformation of the sequence surrounding the tyrosines Y5 79 and Y5 81, thereby increasing binding affinity