a cumulative damage model for the analysis of steel frames under seismic actions
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx
... in activated cells of S phase was also included as test of more functional relevance An important key regulator of the apoptotic pathway such as caspase-3 was also evaluated immunohistologically ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value of the untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...
- 11
- 573
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... significantly different cold-acclimation capacities, we prove that mathematical modelling of metabolism and validation by experimental data offers an attractive possibility for the study of complex...
- 13
- 707
- 0
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan...
- 8
- 482
- 0
Báo cáo y học: "In vitro model for the analysis of synovial fibroblast-mediated degradation of intact cartilage" pptx
... 60°C 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG AGCA-3' [GenBank: NM_174112] ... processed for mRNA analysis of the SFB layer and cartilage For each experimental parameter, patient SFB were analysed separately for each donor After 14 days of in vitro co-culture, multiple layers of ... Human/bovine Aldolase A 5'TCATCCTCTTCCATGAG ACACTCTA-3' 5'ATTCTGCTGGCAGAT ACTGGCATAA-3' [GenBank: NM_000034] 58°C 88°C Human MMP-1 5'GACCTGGAGGAAATCT TGC-3' 5'GTTAGCTTACTGTCACA CGC-3' [GenBank: NM_002421]...
- 20
- 524
- 0
Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx
... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate of the number of actual raw data measurements that underlie each peak Properties of ChIP-chip ... Gaussian distribution with a mean of zero The variance of the observations is estimated by the average sum of the squared negative log ratios Under the null hypothesis, the distribution of the...
- 8
- 334
- 0
QuEChERS A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products
... vigorously for a few seconds The minute extraction of the entire batch can be performed in parallel after the salts have been added to all the samples Michelangelo Anastassiades, CVUA Stuttgart QuEChERS ... Co-extracted fat and waxes may negatively affect the ruggedness of the GC analysis The co-extracted fats or waxes can be separated from the extracts to a large extent by putting them in the freezer ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run of the alkaline aliquot is needed Normally...
- 12
- 729
- 0
Finite element model for nonlinear analysis of steel–concrete composite beams using Timoshenkos beam theory
... A numeerical modell for the lineear analysis and nonlineear analysis of steel conncrete CB with w partial sheear interactio on capable of o accountinng for the shhear deformaability of booth componeents ... nce of the prroposed model against the data of Gaattesco (1999 9) and experrimental dataa The load versus v mid-sspan deflectiion is plottedd in Fig 14 annd the valuess of slip at the t steel conncrete ... daata In Fig 17, it can be noted n that thee curve of thhe analyticaal results liess almost alw ways among the experimenntal results of the two hallves of the bbeam Fig.17 Deflected shappe at...
- 16
- 549
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... result in a gain for others The optimal management of shared stocks is an area that requires collaborative effort among the littoral nations of the Bay of Bengal and the Andaman Sea Demersal fish...
- 88
- 581
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... suitable for a practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated that in the surf zone, the time scale ... wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ...
- 11
- 460
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... select Theta-Alpha band activity on central and temporal channels (TL, TR, CL and CR) for further analysis of our results from univariate analysis In Table we analyze the spectral biomarkers of the ... the Beta band over the frontal lobe For the Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier, the ... from the WT approach (FL, FR, CR, OL from the theta band and FL, PL, OL from the alpha band) and features from the MS-COH approach (FTR, OPL from the Theta band Table 1: Average WT Biomarker Values...
- 14
- 454
- 0
Báo cáo khoa học: " A predictive model for the level of sIgA based on IgG levels following the oral administration of antigens expressed in Sacchromyces cerevisiae" pdf
... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi ... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB( ... yassa nietorp ACB a gnisu derusaem erew elpmas hcae fo snoitartnecnoc nietorp latoT sisylana tneuqesbus rof Co02− ta derots dna detcelloc erew stnatanrepuS Co4 ta nim 01 rof g 000,21 ta noitagufirtnec...
- 5
- 443
- 0
Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf
... and Gianola [8] extended the standard threshold model to a model allowing for heterogeneous variances of the Gaussian latent variables using a log-linear model for the residual variances In the ... to be a natural alternative to the MAP approach proposed by Foulley and Gianola !8! The main advantage of the MAP approach lies in both its conceptual and computational simplicity Part of this ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13...
- 18
- 297
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head...
- 5
- 573
- 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... on the array, the geometric mean of the measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the ... Immunosorbent Assay (ELISA) and Northern blot analysis that not allow for simultaneous multi-target analysis To determine whether a multi-virus microarray had potential in specific applications, for instance ... on the average of the intensity across the array set was then obtained A ratio greater than indicates that there was hybridization to a specific gene 2-fold above the background intensity across...
- 15
- 376
- 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
- 9
- 372
- 0
A model for the prediction of subgrade soil resilient modulus for flexible pavement design
... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... Transportation Research Board (TRB) of the National Research Council, under the sponsorship of the Federal Highway Administration (FHWA) and with the cooperation of the American Association of State ... SEASONAL MONITORING PROGRAM 4.1 Data Acquisition The first and foremost important task for this research was the collection of the required data that could be used for the data analysis The Transportation...
- 104
- 423
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... release in the rat striatum (A) Nicotine acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists ... tool for the specific localization and further characterization of these important subtypes Characterization of nAChR subtypes in the avian ciliary ganglion Another example where a- conotoxins have ... ease of synthesis, makes AuIB is present in intracardiac ganglia, or that the a3 b4* them particularly useful templates for the design of receptors in intracardiac ganglia form a substantially optimized...
- 15
- 757
- 0
TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx
... the plasma A default flow of oxygen is added to the carrier gas flow (e.g Oxygen at 5% of the total argon carrier flow) and the organic solvent is aspirated at an appropriate flow rate The oxygen ... solution into the spray chamber by self-aspiration The spray chamber and plasma torch are made of highpurity quartz and any seals in the sample introduction and drain systems are replaced with solvent ... temperature of -5oC, and a narrow ID torch to maintain plasma stability Performance The ICP-MS sample introduction setup for the analysis of volatile organic solvents such as isopropyl alcohol (IPA) involves...
- 6
- 610
- 0
Improving Recapitalization Planning - Toward a Fleet Management Model for the High-Mobility Multipurpose Wheeled Vehicle ppt
... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... discounted salvage value of the vehicle, and ACMi is the smoothed average cumulative mileage for vehicles of age group i VaRooM also compares the average cost of a candidate vehicle for replacement...
- 92
- 499
- 0
Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt
... into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties which offers the ... initial creation of the situation-type (the first clause), the interpretation of but and the modification of the initial situation-type to accommodate the information in the second clause SPEECH ACTS ... NEGOTIATE Clearly given the manifest success o f urban Japanese u} obtain lucrative foreign contracts, the absence of such a spcech act-type among rural Japanese cannot be attributed to facts of the...
- 4
- 489
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25