a conserved tyrosine cluster on the n terminus of d6 is a key determinant for ligand binding
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... revealed that upon peptide binding, NarJ undergoes a conformational change Isothermal titration calorimetry (ITC) and BIAcore analysis showed that protonation of the chaperone is responsible for ... the interaction (on rate constant kon and off rate constant koff) between NarJ and the NarG(1–15) peptide Taking into account the existence of two subpopulations of NarJ at pH 7, the BIAcore ... basis for peptide recognition by NarJ S Zakian et al Upon peptide binding, NarJ undergoes a conformational change A The temperature dependence of the partial molar heat capacity of free NarJ or NarJT...
- 10
- 685
- 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... is clearly responsible for the enhanced inhibitory potency Conformational alterations of the peptide backbones have to be taken into consideration especially in the case of different amino acid ... molecules one of them bound in the active site and one of them at an alternative site This special, rare type of inhibition is therefore worth examining although the kinetic constants characterize these ... binding site Therefore, the substitution of only one amino acid (Asp2) in the Tat(1–9) sequence resulted in a change of the inhibition mode in conjunction with a gain of the ability to bind at the...
- 10
- 505
- 0
Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx
... substitution of Arg46 on intracellular signalling The stimulation of accumulated InsPs by increasing concentrations of AVP, was assayed for each of the 19 mutant constructs and the dose–response characteristics ... substitution of Arg46 facilitated agonist-induced transition of the V1aR to the active state, signalling was nevertheless still dependent on agonist because an increase in basal signalling was not ... mutation of Arg46 had the dual effect of (a) decreasing agonist affinity and (b) promoting the agonist-induced active conformation due to the loss of a stabilizing constraint on the ground state of the...
- 8
- 487
- 0
Báo cáo Y học: The N-terminus of m5C-DNA methyltransferase Msp I is involved in its topoisomerase activity docx
... Stratagene The sequence of the oligonucleotides for the mutations at the underlined positions were: 5¢-ACATGGC AACAGGCGGAATCAGGTAAA-3¢ (W3 4A) and 5¢-AT ATTCTAGAAAGCTAACCAGAATCAA-3¢ (Y7 4A) The ... (1996) Characterisation of independent DNA and multiple Zn -binding domains at the N terminus of human DNA-(cytosine-5) methyltransferase: modulating the property of a DNA -binding domain by contiguous ... many proteins; the fusions found may simply represent permutations and combinations of a set of common components and may not imply interactions [37] Even though the organisms that harbor these...
- 7
- 515
- 0
Báo cáo khoa học: Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase doc
... spontaneously under a range of conditions raises important questions about the mechanism of cleavage and suggests that cleavage may occur in vivo If it is an in vivo phenomenon, truncation of ... CAACGCATAC-3¢; truncate 4, 5¢-GGGAATTCCATAT GAGCAACGCATACGACGCCGGCATC-3¢; truncate 5, 5¢-GGGAATCCATATGAACGCATACGACGCCGGCA TCATGCAGCTGAAA-3¢; truncate 6, 5¢-GGGAATTCC ATATGGCATACGACGCCGGCATCATGCAGCTGAA ... ATATGGCATACGACGCCGGCATCATGCAGCTGAA A- 3¢; truncate 7, 5¢-GGGAATTCCATATGTACGACGC CGGCATCATGCAGCTGAAA-3¢; truncate 8, 5¢-GGGA ATTCCATATGGACGCCGGCATCATGCAGCTGAA A- 3¢; truncate 9, 5¢-GGGAATTCCATATGGCCGGCAT CATGCAGCTGAAAGGCAAG-3¢;...
- 9
- 288
- 0
A STUDY ON THE STRUCTURAL FEATUES OF ENGLISH NEWS STORY.DOC
... that is the most typical mean of indicating language as well as indicating any change of language and life Because language is a mean of human interaction and people are social beings in a society ... local or regional or national or international level The main conveyor of news is newspaper Neither the advent of television nor that of internet could affect the importance of the newspaper The ... taken into consideration analysis, transferring, restructuring and testing Analysis consists of essentially of determining the meaning of the whole story In other words, all the content of the...
- 62
- 1,108
- 5
A STUDY ON THE STRUCTURAL FEATUES OF ENGLISH NEWS STORY
... impart news by the language And it is newspaper that is the most typical mean of indicating language as well as indicating any change of language and life Because language is a mean of human interaction ... regional or national or international level The main conveyor of news is newspaper Neither the advent of television nor that of internet could affect the importance of the newspaper The reason for ... and in the second one Such a sentence can exist only when each half of it is an independent unit of information Under that circumstance, the reader needs not to read this half to understand the...
- 62
- 377
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... probably be classed under the head I am now considering One of his relations has sent me the following account of his early and sudden decease : " He was found dead in his bed on a Monday morning ... effects of training and Boat-racing on their health I have endeavoured to discuss this much vexed question in an honest and impartial spirit I entered on the enquiry without any personal bias in the ... board the " London" in the Bay of Biscay, another was drowned in swimming a young horse across a river in Australia, another was murdered by poachers, and another accidentally shot Turning from these...
- 419
- 541
- 0
Tài liệu Incentive Compensation Practices: A Report on the Horizontal Review of Practices at Large Banking Organizations pdf
... banking organizations and undermine existing controls For example, unbalanced incentive compensation arrangements can place substantial strain on the risk-management and internal control functions ... risk-management processes and internal controls to reinforce and support the development and maintenance of balanced incentive compensation arrangements Risk-management and control personnel are engaged ... functions of even well-managed organizations Therefore, risk-management and internal control functions should be involved in designing, implementing, and evaluating incentive compensation arrangements...
- 34
- 686
- 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... using IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage Reassociation and quantification ... electrophoresed on an agarose/formamide gel rRNAs were quantified from digital images using IMAGEQUANT software The depurination was calculated by relating the amounts of small aniline-fragment and 5.8S rRNA ... Expression and purification of ricin A chain variants A single colony of Escherichia coli JM101 transformed with the pUTA vector [14] containing the appropriate RTAvariant sequence was used to inoculate...
- 10
- 616
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... urea solution and then run on SDS ⁄ PAGE Lanes a and d, in the absence of both TnC and Ca2+; lanes b and e, in the presence of TnC and the absence of Ca2+; lanes c and f, in the presence of both ... contraction [10] TnC interacts with both TnI and TnT The TnC–TnI interaction and changes in the interaction upon Ca2+ binding to TnC have been intensively studied as the central mechanisms of ... regulatory TnCbinding site to the C -terminus of Akazara scallop TnI is not important for this regulation, and that Akazara scallop troponin acts through mechanisms in which the region spanning...
- 12
- 514
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... material is available online: Fig S1 Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species This material is available as part of the online article ... by the addition of Vta1p and a Vps4p protein containing an intact C-terminal helix Based on our experimental data and bioinformatic analysis, we propose a model for the role of the C-terminal...
- 23
- 490
- 0
Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf
... ClpA consists of three domains: an N- domain and two ATP -binding domains referred to as the D1 and D2 domains Interestingly, deletion of the N- domain from ClpA not only abolishes binding of the adaptor ... functional interaction between ClpS and the N- domain of RR ⁄ AA, and this result suggests that neither the local nor the overall structure of the RR ⁄ AA mutant was compromised Mutation of the conserved ... standard, and refer to the protomer Unfolding and protein degradation assays GFP–ssrA degradation was monitored by changes in fluorescence (excitation at 400 nm and emission at 510 nm) Degradation...
- 11
- 434
- 0
Báo cáo khoa học: Effect of oculopharyngeal muscular dystrophy-associated extension of seven alanines on the fibrillation properties of the N-terminal domain of PABPN1 pot
... their activity upon incubation, may be responsible for the only moderate acceleration of fibril formation of N- WT by seeds Consequently, an increase in the protein concentration and ⁄ or temperature ... filtration as published [26] Purified protein Fibrils were formed by incubation of N- (+7)Ala at a concentration of mm for 30 days and N- WT at a concentration of mm for 100 days When fibril formation ... simultaneous presence of both amorphous aggregates and fibrils hampered the analysis of fibril formation kinetics For this reason, fibril formation was analyzed with the N- terminal domain of PABPN1 consisting...
- 10
- 529
- 0
International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part I: upper facial wrinkles potx
... preparation Patient management Patient education and counselling are integral parts of the BoNT -A treatment It is essential for the patients to have a realistic expectation of the treatment outcome, ... results As there are only a few clinical studies and regional guidelines available on the offlabel indications,12–18 international consensus recommendations would be helpful in providing a general ... solution to obtain a final concentration of 200 s U ⁄ mL (10 s U ⁄ 0.05 mL) This was the concentration used in the majority of international clinical studies for the treatment of glabellar lines...
- 7
- 742
- 1
International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part II: wrinkles on the middle and lower face, neck and chest pdf
... on the lateral part of the nose In some patients, the wrinkles also exist on the dorsal part of the the procerus, the nasalis and the depressor septi nasi The nasalis is the main muscle responsible ... indications,21–28 international consensus recommendations should be helpful in providing a general guideline for efficacious and safe injection of BoNT -A (Speywood Unit) Consensus recommendations on ... periosteum The orientation of the injection should be perpendicular, with an angle of about 45° to the nasal bone To slightly raise the nasal tip, one injection at the base of the columella is recommended...
- 11
- 772
- 1
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... nucleotide binding to and phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in ... Efcient dissociation of the individual subunits of the wild type ACL was conrmed in lanes and The individual subunits of the H27 3A mutant Fig Phosphorylation and dephosphorylation of Cl-ACL and the ... occurred in the absence of CoA Taking into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters ... coefficient α1 augments, the mode photon density n1 is increased and the one of mode n is diminished (see Fig 1a) However, when the gain coefficient α augments, the transformation of photon densities ... saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ∪ P0 ), n n area(Pqn+1 ∪ Pqn+1 ), area(Qn ... boundary of a drop U of minimal generation It then follows the boundary of U along a nontrivial arc I Finally, it returns along the boundaries of another chain of descendants of U until it reaches ... decomposition to a unique cell of level n of the second decomposition, with the dilatation depending only on the (n + 1)-st term an+1 of the continued fraction expansion of the rotation number θ The...
- 53
- 383
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose