Báo cáo khoa học: Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase doc

Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase Anastasia J. Callaghan*, Thomas J. Smith†, Susan E. Slade and Howard Dalton Department of Biological Sciences, University of Warwick, Coventry, UK Soluble methane mono-oxygenase (sMMO) of Methylo- coccus capsulatus (Bath) catalyses the O 2 -dependent and NAD(P)H-dependent oxygenation o f methane and numer- ous other substrates. During purification, the sMMO enzyme complex, which comprises three components and has a mole cular mass i n excess o f 300 kDa, becomes i nac- tivated because o f cleavage of just 12 amino a cids f rom the N-terminus of protein B , which is the smallest component of sMMO and the only one without prosthetic groups. Here we have shown that c leavage of protein B, to form the inactive truncated p rotein B ¢, continued t o occur when intact protein B was repeatedly separated from protein B¢ and all detec t- able contaminants, giving compelling evidence that the protein was cleaved autocatalytically. The rate of autocata- lytic cleavage decreased when t he residues flanking the cleavage site were mutated, but the position of cleavage was unaltered. Analysis o f a series of incremental truncates showed that residue(s) e ssential for the activity of sMMO, and important in determining the stability of p rotein B, lay in the r egion Ser4–Tyr7. Protein B was shown to possess intrinsic nucleophilic activity, which we propose initiates the cleavage react ion via a novel mechanism. Proteins B and B¢ were detected in approximately equal amounts in the cell, showing th at truncation of protein B is biologically relevant. Increasing the growth-medium copper concentration, which inactivates sMMO, did not alter t he extent of in vivo cleav- age, therefore the conditions under which cleavage of protein B may fulfil its proposed role as a regulator of sMMO remain to be id entified. Keywords: autocatalytic inactivation; methane mono-oxy- genase; methanotroph; N-terminal autoprocessing; regula- tory protein. Methane mono-oxygenase (MMO) catalyses the oxidation of methane to methanol and is essential for the growth of methanotrophic bacteria u sing methane a s the growth substrate [1]. Methanotrophic bacteria such as Methy lococ- cus capsulatus (Bath) possesses two forms of MMO, the copper-requiring particulate form (pMMO) and the iron- containing so luble form (sMMO), the expression of which is regulated by the concentration of available copper in the medium [2]. sMMO, which catalyses the NAD(P)H-depen- dent and O 2 -dependent oxygenation of methane and numerous adventitious substrates, is an enzyme complex consisting of three components: a multisubunit hydroxylase, a r eductase, a nd a regulatory component known as p rotein B[3]. The hydroxylase (250.1 kDa) has an (abc) 2 quaternary structure [4] in which each a subunit contains a l-(hydr) oxo-bridged di-iron centre that is the presumed site of substrate oxygenation [5,6]. The reductase (38.5 kDa) contains FAD and Fe 2 S 2 centres and supplies electrons from NADH to the hydroxylase [7]. Protein B (16 kDa) , which is devoid of p rosthetic groups and metal cofactors, is essential for natural, O 2 -dependent substrate oxygenation by the sMMO complex [3]. Owing to its diverse effects on the catalytic pro perties of sMMO, protein B is potentially a powerful regulator of sMMO activity. Protein B has been shown to ( a) couple electron transfer to substrate oxygen- ation thus converting sMMO from an oxidase into a n oxygenase [8]; (b) reduce the redox potentials of t he di-iron site [9,10] and hence inc rease the reactivity of the diferrous di-iron site to oxygen; (c) accelerate formation of the high- valent intermediate Q, which appears to be responsible for oxygenation of m ethane [11–13]; (d) alter product distri- bution with complex substrates [14,15]; and (e) inhibit oxygenation reactions when the hydroxylase is artificially activated by hydrogen peroxide v ia the p eroxide shunt reaction [14]. Protein B binds to the hydroxylase [16] but not directly to the reductase [17]. There are currently no high-resolution structural data for the complex formed between protein B and the hydroxylase; however, a cross-linking study using the homologous sMMO of Methylosinus trichosporium OB3b showed that protein B bound to th e a subunit [18]. A variety of spectroscopic techniques have demonstrated that protein B perturbs the environment of the di-iron s ite, presumably by altering the conformation of the hydroxylase [19–21]. Consistent with this, small-angle X-ray scattering Correspondence to H. Dalton, Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. Fax: + 44 24 7652 3568, Tel.: + 4 4 2 4 7652 3552, E-mail: hdalt on@bio.warwick.ac.uk Abbreviations: ESI, electrospray ionization; GST, glutathione S-transferase; SAXS, small angle X-ray scattering; s /pMMO, soluble/ particulate methane mono-oxygenase. Enzyme: m ethane monooxygenase (EC 1.14.13.25). *Present address: Department of Biochemistry, University of Cambridge, Old Addenbrookes Site, Cambridge , UK. Present address: Biomedical Research Centre, Sheffield H a llam University, Howard Street, Sheffield, U K. Note: a web page is available at http://www.bio.warwick.ac.uk/dalton/ (Received 8 November 2001, revised 6 February 2002, accepted 8 February 2 002) Eur. J. Biochem. 269, 1835–1843 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02829.x (SAXS) has given direct, though low-resolution, structural evidence for a large conformational change in the hydrox- ylase that protein B and the reductase together ind uce [22]. Thus, current evidence suggests t hat protein B influences sMMO activity through the conformational change that it causes in the hydroxylase, although a direct role in transferring electrons from the reductase to the hydroxylase is also possible. The NMR structure of protein B from Mc. capsulatus (Bath) [23] shows that it has a folded central, two- domain core region, while the N-terminal region until Val31 and the C-terminus (Met130–Ala140) are mobile and largely unstructured. NMR measurements in the presence of the hydroyxlase showed exchange broadening of specific nuclear Overhauser effect cross-peaks that grouped around the so-called ÔnorthernÕ domain of the core of protein B [23]. These results were interpreted as showing that hydroxylase-bound and unbound protein B were in dynamic equilibrium and that the hydrophobic ÔnorthernÕ half of the c ore of protein B interacted w ith the hydroxylase. Docking studies showed that protein B could bind in the hydrophobic cleft formed by two of the four iron-co-ordinating a h elices that lie in a canyon formed betw een th e ab pairs of the hydroxylase [6,23–25]. Protein B from Mc. capsulatus (Bath) is unusually sensitive to inactivation because of truncation reactions. During and after purification, protein B degrades by cleavage, principally between Met12 and Gly13, to give protein B¢, w hich is completely inac tive in the sMMO whole-complex reaction [16,26]. Cleavage is also observed between Gln29 and Val30, giving protein B¢¢,whichisalso inactive [16]. Mutagenesis studies have shown that the residues around the cleavage site influence the rate of inactivation. Mutation of the Met12–Gly13 cleavage sit e in protein B of the Mc. capsulatus (Bath) site to Met12–Gln13, equivalent to the site f ound in Ms. trichosporium OB3b protein B (in which truncation had not been reported), enhanced the stability o f t he protein [16]. The triple m utant G10A/G13Q/G16A was a lso resistant to truncation but had diminished activity [27]. Protease inhibitors did not prevent cleavage of protein B, a nd recombinant protein B expressed in a protease-deficient strain of Escherichia c oli was cleaved to protein B¢ [16] despite the absence of Mc. capsulatus- specific proteases and the major intracellular proteases of E. coli. It is remarkable that the sMMO complex, the compo- nents of which total  300 kDa, is exquisitely sensitive to inactivation by removal of just 12 amino acids from the unstructured terminus of its smallest component. The fact that those 12 amino acids are lost spontaneously under a range o f conditions raises important questions about the mechanism of cleavage and suggests that cleavage may occur in vivo.Ifitisanin vivo phenomenon, truncation o f protein B offers a possible mechanism to control the amount of active protein B within the cell and thus regulate the rates of methane oxidation and NADH consumption by sMMO, e.g. in response to i ntracellular or extracellular conditions. To address these q uestions, we conducted a detailed characterization o f the mechanism of cleavage, the roles of specific amino acids near to the N-terminus in catalytic activity, and the significance of the cleavage reaction in vivo. MATERIALS AND METHODS Bacterial growth sMMO-expre ssing Mc. capsulatus (Bath) cells were grown in nitrate minimal salts medium using methane as the growth substrate, as described previously [7]. The switch from sMMO to pMMO expression was e ffected in fermen- tor cultures by increasing t he CuSO 4 .5H 2 O concentration of themediumfrom0.1to1.0mgÆL )1 . E. coli strains were grown a t 37 °C i n L uria–Bertani broth [28], with ampicillin (100 lgÆmL )1 ) added for selection of plasmids a s required. Purification of the sMMO components from Mc. capsulatus The hydroxylase, reductase and protein B components of sMMO were purified from Mc. capsulatus (Bath) as described previously [22,29]. As protein B underwent truncation during purification, protein prepared b y this method contained a mixture of proteins B and B¢.The relative abundance of p roteins B and B¢ was assessed b y using SDS/PAGE and electrospray ionization (ESI)-MS. Incubation of the purified protein B /B¢ mix at 20 °Cfor 1–2 d ays enabled complete conversion of protein B to B¢. Separation of proteins B and B¢ by chromatofocusing chromatography Chromatofocusing chromatography was achieved using a Mono P FPLC column (HR 5/20) (Amersham Ph armacia). The column was equilibrated with buffer A (25 m M methylpiperizine, p H 5.64 or 5.7) before loading of the protein in the same buffer. Elution using buffer B [1 : 10 dilution of PolyBuffer 74 TM (Amersham P harmacia)] at either pH 3.5 or 4, with a flow rate of 0.3–1.0 mLÆmin )1 over 15 col. vol., separated proteins B and B ¢ according t o the difference in their isoele ctric pH. Genetic manipulations The construct for expression of the M12A/G13Q double mutant of protein B was made by amplification of mmoB (which encodes protein B) from pGEX-WTB [16] by PCR with primers mmoB-M12A/G13Q-1 (5¢-CGCGGATCC ACGATGAGCGTAAACAGCAACGCATACGACGCC GGCATC GCGCAGCTGAAAGGCAAG-3¢;M12Aand G13Q mutations shown in bold, start codon in italics and BamHI site underlined) a nd primer mmo B-2 (5¢-GGCGAA TTCTAAGCGTGATAGTCTTCGAG-3¢; EcoRI site underlined) and cloning into the glutathione S-transferase (GST)-fusion expression vector pGEX-2T (Amersham- Pharmacia) using BamHI and EcoRI. The plasmids for expression of the C-terminally 6-His- tagged G13Q mutant of protein B and N-terminal trunca- tions thereof were c onstructed b y PCR amplification of the appropriate section of mmoB using pGEX-mtB [16] a s the template and cloning into pET3a (Novagen) using NdeIand BamHI. The truncated constructs and the proteins they encoded were numbered according to the fi rst amino a cid after the start codon. The forward PCR primers for the various constructs were as follows: G13Q-tag (full-length construct), 5¢-GGGAATTCCATATGAGCGTAAACAG 1836 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002 CAACGCATAC-3¢;truncate4,5¢-GGGAATTCCATAT GAGCAACGCATACGACGCCGGCATC-3¢; truncate 5, 5¢-GGGAATCCATATGAACGCATACGACGCCGGCA TCATGCAGCTGAAA-3¢;truncate6,5¢-GGGAATTCC ATATGGCATACGACGCCGGCATCATGCAGCTGAA A-3¢;truncate7,5¢-GGGAATTCCATATGTACGACGC CGGCATCATGCAGCTGAAA-3¢;truncate8,5¢-GGGA ATTCCATATGGACGCCGGCATCATGCAGCTGAA A-3¢; truncate 9, 5¢-GGGAATTCCATATGGCCGGCAT CATGCAGCTGAAAGGCAAG-3¢; truncate 10, 5 ¢-GGG AATTCCATATGGGCATCATGCAGCTGAAAGGCA AG-3¢; truncate 13, 5¢-GGGAATTCCATATGCAGCTG AAAGGCAAGGACTTC-3¢ (Nd eI sites underlined and start codons italicized). The PCR reverse primer was the same in each case (5¢-TGTATAGGATCCTCAGTGATGG TGATGGTGATGAGCGTGATAGTCTTCGAG-3¢;His 6 tag shown in bold, stop codon italicized, and BamHI restriction site underlined). The absence of unwanted mutations from all cloned PCR products was confirmed by DNA sequencing. Purification of recombinant protein B derivatives The GST-tagged wild-type, G13Q and M12A/G13Q deriv- atives of protein B were purified from strains of E. col i AD 202 containing the appropriate plasmids by affinity chromatography [16]. The GST affinity tag was removed by the addition of thrombin [2 ng thrombinÆ(lgfusion protein) )1 ] for 5–10 min at room temperature, after which the recombinant protein B derivative was separated by gel filtration with a Superdex 75 FPLC column (2.6 cm · 61 cm; Amersham Pharmacia), eluted with 25 m M Mops buffer, pH 7. Plasmids for expression of t he His 6 -tagged p rotein B derivatives were transformed into E. coli BL21(DE3) (Novagen). Cells were grown, induced with isopropyl thio- b- D -galactopyranoside, and soluble extracts were prepared as described previously [16], except that the cells were broken in 20 m M sodium phosphate buffer, pH 7.4–7.6, containing 0.5 M NaCl a nd 10 m M imidazole. Purification of the His 6 -tagged protein B derivative was accomplished using t he HisTrap TM kit ( Amersham Pharma cia) according to the manufacturer’s instructions. The purified fusion protein was then exchanged into 25 m M Mops buffer, pH 7, by gel filtration as described above. Determination of protein concentration Concentrations of protein B and protein B¢ samples were determined spectrophotometrically at 280 nm using the absorption coefficients 16 839 M )1 Æcm )1 and 16 032 M )1 Æcm )1 , respectively, which were determined experimentally by established methods [30,31]. Concentra- tions of the h ydroxylase and reductase were determ ined by the method of Bradford [32] using B SA as the protein standard and commercially available reagent (Bio-Rad). Enzyme assays The semiquantitative naphthalene oxidation test to detect sMMO activity in liquid c ulture samples w as performed as previously described [ 33]. Quantitative propylene oxidation assays using the whole sMMO complex (hydroxylase, reductase and protein B) were performed by the method of Pilkington & Dalton [29]. The effect of protein B derivatives on the propylene oxidation activity of the hydroxylase via the peroxide shunt reaction was measured in the presence of 24 l M hydroxylase a nd 100 m M hydrogen peroxide as published [ 14], except that the epoxypropane product was quantified by GC of 0.5-mL gas-phase samples. Circular dichroism Protein samples in 25 m M sodium phosphate buffer were scanned 10 t imes in a Jasco J715 spectropolarimeter in a 1-mm path-length quartz cuvette between 190 nm and 250 nm (for far-UV CD analysis) or in a 1-cm path-length quartz cuvette between 260 nm and 300 nm (for near-UV CD). In all cases the response t ime w as 0.25 s and the scan speed was 100 nmÆmin )1 . Scans were blanked a gainst fresh buffer recorded under the same conditions. Fluorescence Protein samples in 25 m M sodium phosphate buffer, pH 7, were placed in a 3-mL quartz cuvette with a 10-mm path length. Fluorescence measurements were made using a PerkinElmer L S-50 fluorimeter at room temperature with a scan speed of 500 nmÆmin )1 and a n excitation wavelength of 280 nm, and scanned over the range 300–450 nm. An accumulation of eight scans w as taken for each sample, and scans were blanked against buffer data collected under the same conditions. Other methods Protein B-associated nucleophile activity was measured at 20 °C by the protein B -dependent conversion of p-nitro- phenylacetate to p-nitrophenol, monitored spectrophoto- metrically at 400 nm [34]. SDS/PAGE [35] was performed using 12% (w/v) polyacrylamide gels. SDS cell e xtracts of Mc. c apsulatus cells were prepared from cells harvested by centrifugation (14 000 g, 5 min, room temperature), which were immediately resuspended in SDS/PAGE loading buffer [65 m M Tris/HCl (pH 8.8), 1 m M EDTA, 1% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, 0.0025% (w/v) brom- ophenol blue, 10% (v/v) glycerol] and boiled (100 °C, 5 m in) b efore c entrifugation ( 10 000 g,10min)toremove particulate material. Preparation o f anti-(protein B) serum, Western blotting, and E SI-MS were as described previously [16]. RESULTS Cleavage of protein B did not require detectable extrinsic proteases To determine whether the proteolytic activity responsible for cleavage w as intrinsic or extrinsic to protein B, proteins BandB¢ were separated from one another by chomatofo- cusing chromatography on a Mono P column. The p rotein B used for this separation was a highly purified sample [prepared from Mc. capsulatus (Bath), with a specific activity of 3500 nmolÆmin )1 Æmg )1 ] that had undergone partial cleavage. SDS/PAGE analysis of this sample s howed Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1837 that it contained proteins B, B¢ and B¢¢ in the proportions 10 : 6 : 1, and MS analysis confirmed the presence of proteins with masses of 15 852, 14 629 and 12 718 Da, which corresponded to the calculated masses of proteins B, B¢ and B¢¢. On chromatofocusing the sample could be readily resolved into proteins B, B¢ and B¢¢. Immediate SDS/ PAGE analysis of the protein B fraction at this stage showed it to be pure by Coomassie Blue s taining, and it was active (6380 nmolÆmin )1 Æmg )1 ) by the propene oxidation assay. In contrast, no activity could be detected from the fraction elu ted as protein B¢. The active protein B was then subjected to further rounds of chromatofocusing, and on each occasion the protein was resolved into B and B¢. During these operations, the highly purified protein B was observed to degrade by 50% to B¢ over a 3-h period at 20 °C. This spontaneous truncation o f highly purified samples of protein B upon repeated repurification, despite the absence of detectable contaminating proteins, strongly suggested that truncation was autocatalytic. Effect of the structure of the cleavage site on protein B activity and the cleavage reaction We were interested to investigate the roles of the residues near to the cleavage site in the r ate and position of cleavage because it seemed likely that the side chains near to the cleavage site were important in the autocatalytic cleavage process. We had already shown that the G13Q mutation, which changed the amino acid immediately C-terminal to thecleavagesite,reducedtherateoftruncationofproteinB [16], but the precise position of cleavage in this mutant had not been determined. A fter a preparation of the G13Q mutant protein h ad been incubated at 20 °C for 48 h, ESI- MS analysis revealed the presence o f two major molecular ions, o f 1 6 300 Da (corresponding to the mass of the intact G13Q mutant) and 14 700 Da (corresponding to the mass of a truncate beginning at Gln13). This illustrated t hat replacement of the small Gly13 with the bulkier, hydrophilic Gln did not affect the principal site of cleavage of protein B, which remained immediately N-terminal to residue 13. To investigate the role of the residue immediately N-terminal to the c leavage site and to see whether the G13Q mutant could be further stabilized by removal of side- chain functionality at this position, the M12A/G13Q mutant was constructed. The activity of this double mutant was indistinguishable from that of the w ild-type ( data not shown), and ESI-MS analysis of the freshly prepared mutant protein confirmed the predicted molecular mass of 16 240 Da. Analysis of a sample that had been incubated at 20 °C for 48 h showed that the major new molecular ion had a mass of 14 701 Da, which corresponded to the mass of the truncate p roduced by cleavage between amino a cids 12 and 1 3. Thus, despite radically ch anging the a mino acids on both sides of the cleavage site, the position of c leavage was unchanged and the protein remained active. A surprising difference between the wild-type and mutant forms o f p rotein B was observed during the peroxide shunt reaction. The peroxide s hunt, which allows the hydroxylase to be activated by hydrogen peroxide to perform oxygen- ation reactions in the a bsence of the reductase and NADH, is inhibited by intact wild-type protein B [14]. Just as the stimulatory effect of protein B¢ in the whole-complex sMMO reaction was much lower than that of intact protein B, the inhibitory e ffect of protein B¢ during the peroxide shunt was markedly lower than that of protein B (Fig. 1). However, the intact G 13Q and M12A /G13Q mutant forms of protein B, both of which had wild-type activity in the whole-complex reaction, were significantly poorer inhibitors of the peroxide shunt reaction than wild-type protein B (Fig. 1 ). Thus the inhibitory effect of protein B was more sensitive to structural changes near to the N -terminus than its better-documented stimula tory effec t. As previous SAXS studies had indicated t hat protein B elongated on truncation [22], we studied the effect of truncation on the overall conformation of protein B so as to assess whether the inactivity of protein B ¢ is associated w ith a conformational change. However, far-UV CD spectra of proteins B and B ¢ were identical (data not shown), showing that truncation caused no detectable change in the second- ary-structure content of the protein. Likewise, near-UV CD and fluorescence spec tra were s carcely different for proteins BandB¢, showing little difference in the environments of aromatic side chains between the full-length and truncated proteins (data not shown). These data, t aken together with the SAXS study, are consistent with a relatively minor change in conformation on truncation of free protein B. Similar structural studies were performed with the two mutant forms of protein B and their respective truncates, and the results were indistinguishable from those obtained with the wild-type protein B/B¢ system (data not shown). Incremental truncation of protein B To investigate more thoroughly the role of the N-terminal region in the t runcation reaction and in the activity o f protein B, a series of N-terminal truncates was constructed genetically. These all contained the stability-enhancing G13Q mutation to minimize loss of additional amino acids by spontaneous cleavage and h ad a C-terminal 6-His t ag to Fig. 1. Inhibition of the p eroxide s hunt reaction by protein B and its derivatives. Oxygenation of propylene was measured i n the presence of the hydroxylase and hydrogen peroxide as described in Materials a nd methods at various concentrations of intact wild -type protein B (solid line), intact G13Q (b roken line) or M12A/G13Q (dashed line) mutan t protein B or protein B ¢ derived from wild-type protein B (dotted line). Enzyme activity is shown as a percentage of the activity [9.2 nm olÆmin )1 Æ(mg of hydroxylase) )1 ] with no added protein B. The activities presented are the mean of three or four separate experiments. Standard error bars a re shown. 1838 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002 permit affinity purification while allowing free manipulation of the N-terminus. ESI-MS of the full-length and truncated proteins confirmed their integrity and showed whether the initial methionine residue was preserved (Fig. 2). The C-terminal His 6 tag had no effect on activity because the activity of the full-length fusion (G13Q–His 6 )wasapprox- imately the same as that observed f or the original G13Q mutant with no C-terminal tag. Full activity was retained on truncation as far as Asn5 (truncate 5), but truncation beyond this led to progressive loss of activity until truncate Asp8 (truncate 8), when activity was lost completely (Fig. 3). The c leavage of the t runcates was analysed t o investigate the role of the N-terminal region in the cleavage process. ESI-MS analysis was performed at 24-h intervals during incubation at 20 °C over 6 days. The full-length construct G13Q-tag was detectable for 3 days. Truncate 4 was less stable, having completely degraded to truncates within 24 h, whereas the shorter truncates 5, 6 and 7 w ere still observed in uncleaved form after 6 days. Further truncation beyond this, to t runcates 8 and 9, which abolished activity, also enhanced the cleavage reaction, which was complete within 24 h. General d estabilization or reorganization of the secondary structure of the truncated forms was unlikely to be the cause of their destabilization o f the truncates because the far-UV CD spectra for truncates 7 (stable) and 8 (rapidly cleaving) w ere indistinguishable a nd very similar to that of native, intact protein B ( data not shown). Truncates 10 and 13, both of w hich retained the scissile Met12–Gln13 peptide bond (Fig. 2), were as stable for a t least 6 days, showing t hat at least four of the amino acids N-terminal t o the cleavage site are required for rapid autocatalytic cleavage. Mechanism of autocatalytic cleavage The probable autocatalytic mechanism of cleavage of protein B posed the question o f which intrinsic groups on protein B were responsible for the reaction. Recent r esearch has identified autoprocessing reactions in other systems, such as aminohydrolase and aspartate decarboxylase, which rely on the formation and r esolution of internal (thio) e sters [36,37]. In these examples, a nucleophilic amino a cid (cysteine, serine or threonine) rearranges within th e protein, thus replacing the amide peptide bond between itself and t he preceding amino acid with a more reactive thioester or ester linkage. Such bonds then hydrolyse spontaneously and thus effect cleavage [38–40]. In wild-type protein B, the a mino acid on the C-terminal side of the c leavage site is g lycine and so n ucleophilic attack from this site is impossible. Nevertheless, it was possible that cleavage of protein B occured v ia a similar chemical mechanism, initiated by attack from a nucleophile elsewhere in the p rotein. This w ould transfer t he N-terminal region of the protein on to a (thio)ester linkage on the nucleophile, which would t hen spontaneously hydrolyse to yield the truncated protein (Fig. 4). To investigate the feasibility of such a mechanism, the protein was tested for the presence of accessible nucleo- phile(s) by reac tion with p-nitrophenylacetate, which reacts with nucleophilic groups to form p-nitrophenol [34]. The results (Fig. 5) indicated that a nucleophilic group was indeed present, because an increased reaction rate of p-nitrophenol formation was observed in the presence of increasing concentrations of protein B. Control reactions (Fig. 5 ) confirmed that the rate of p-nitrophenol production was significantly higher than the background rate that was observed in the absen ce of p rotein or when denatured (boiled) protein B or the hydroxylase were used. Detection of protein B¢ in vivo To investigate the in vivo significance of truncation of protein B, sMMO-expressing Mc. capsulatus (Bath) whole cells were analysed for the presence of proteins B and B¢. Mc. c apsulatus (Bath) was cultivated under low-copper, oxygen-limiting conditions as described in Materials and methods. A positive naphthalene oxidation t est confirmed the expression of s MMO because pMMO is inactive with this substrate [33]. The cells were rapidly harvested and Fig. 2. Deduced N-terminal sequences o f the incremental truncates of protein B , each o f which was constructed in the G13Q background and had the C-terminal 6-His tag. The presence of the initial m ethion ine residues (sh own in bold) was determined experimentally by ESI-MS. The site o f cleavage f or formation of protein B ¢ is indic at ed. Fig. 3. Effect of incremental truncation on the activity of protein B. Activity was measured as the rate of propene oxygenation in the presence o f e x cess h ydroxylase a nd reductase and is shown as a per- centage o f th e ac tivity [1 956 n m olÆmin )1 Æ(mg p rotein B) )1 ]observed with the G13Q mutant prepared using the GST-tag system (G13Q). The activities presented are the mean of t hree or four s eparate exper- iments. Standard error bars are shown. Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1839 immediately boiled in SDS-containing sample-loading buf- fer, thus capturing the cellular proteins with minimal opportunity for degradation before exposure to the dena- turant. SDS/PAGE and Western-blotting analysis, using anti-(protein B) sera (that cross-reacted with protein B¢), clearly s howed that protein B¢ was present in vivo in sMMO-expressing cells of Mc. capsulatus (Bath) (Fig. 6). Control samples from pMMO-expressing cells (grown Fig. 4. Proposed m echanism for autocatalytic cleavage o f protein B . A n ucleophilic side chain, probably on t he surface of the folded core region of protein B, is proposed to attack the carbonyl g rou p of the s cissile peptide bond. Cleavage then follows via cyclic zwitte- rion and e ster intermediates as i ndicated. Fig. 5. Nucleophilic activity of p rotein B. Formation of p-nitropheno l from p-nitrophenyl acetate was m onitored spec trophot ometrically as described in Mate rials and M ethods. T he reac tion mixtures c ontained protein B at 1 mgÆmL )1 (dotted line), protein B at 0.5 mg ÆmL )1 (broken line), boiled protein B at 1 mgÆmL )1 (dashed line), h ydroxy- lase at 1 mg ÆmL )1 (broken/dotted line) and no p rotein (solid line). Fig. 6. Detection o f protein B in vi vo. Western b lot probed with a nti- (protein B) sera showing SDS cell extracts of Mc. capsulatus (Bath) from fermentor cultures expressing (lane 1) sMMO and (lane 2) pMMO (negative control containing no protein B or B¢). Molecular masses of standards are indicated in kDa. 1840 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002 under high-copper conditions), which did not exhibit sMMO activity, confirmed t hat the proteins that reacted with the antisera corresponded to proteins B and B¢. These results strongly suggested that protein B degraded to B¢ in viv o and were consistent with the hypothesis t hat th e cleavage reaction may serve to control the in vivo activity of sMMO. One possibility w as that conversion of protein B to B¢ may a ccount, at least in part, for the observed inactiva- tion of sMMO when the growth-medium copper concen- tration was increased, which also causes cessation of sMMO expression and i nduces the copper-dependent pMMO, via the so-called c opper switch [2,41]. Experiments were there- fore conducted to determine whether addition of copper to a Mc. c apsulatus (Bath) culture altered the cellular levels of proteins B and B¢ during the switch from sMMO to pMMO expression. The a bundances of proteins B and B¢ remained constant throughout the t ime course, even until the cells began to express pMMO, and so formation of protein B¢ did not appear to control the activity of sMMO during t he copper switch. DISCUSSION Mechanism of truncation Previous o bservations that protein B underwent cleavage during purification re gardless of whether it had been expressed in Mc. capsulatus or E. coli,evenwhenthe protein h ad been purified to apparent homogeneity [16], had shown that either truncation w as autocatalytic o r the peptide bond between amino acids 12 a nd 13 was unusually susceptible t o digestion by very small amounts of extrinsic proteases. Here, by demonstrating that repeatedly repurified protein B con tinued to undergo cleavage, we have provided strong evidence that the cleavage reaction is independent of the presence of contaminating proteins and so is almost certainly autocatalytic. The insensitivity of the position o f cleavage to the amino- acid sequence a round the c leavage site implies t he involve- ment of other parts of the structure in determining the sensitivity of the scissile peptide bond to cleavage. Intrinsic nucleophilic activity within protein B is consistent with a cleavage mechanism that proceeds via an intramolecular rearrangement b eginning with attack on the scissile peptid e bond by a n ucleophilic amino-acid side chain elsewhere in the protein (Fig. 4 ). Thus we are able to p ropose the first credible mechanism for autocatalytic cleavage of protein B . This could explain both t he occurrence o f cleavage and its position, determined by distance constraints when t he flexible N-terminal region approaches the nucleophile, which we suspect resides on the core of the p rotein. The core of protein B [23] has 12 exposed potential nucleophiles (serines 34, 44, 92, 109, 110, 126; t hreonines 36, 49, 57, 68, 111, 117, 123, 125 ; cysteine 88), all of which are exposed to the solvent, and so the precise residue(s) involved cannot currently be assign ed. The residues flanking the cleavage site do affect t he rate o f cleavage, perhaps by altering the steric accessibility of the scissile peptide linkage to the nucleophile. It was also interesting to note that, as the protein was progressively shortened from the N-terminus, a marked decrease in stability w as observed conco mitant with loss of activity, but stability was re stored after removal of a further two amino acids. If binding of protein B to the hydroxylase prevented the N-terminal region from approaching the nucleophilic group (e.g. by the nucleophile being occluded by binding to the hydroxylase) the presence of the hydroxylase may also serve to stabilize protein B. Role of the N-terminus in catalysis By constructing a series of incremental truncates, we have shown that the amino acids from the N-terminus to Ser4 are not required for catalysis. As truncation beyond Ser4 led to progressive loss of activity until the truncate that began with Asp8 (truncate 8), which w as inactive, the critically impor- tant N-terminal region appears to correspond to Ser4-Asn5- Ala6-Tyr7. We presume t herefore that the p resence of these residues is essential for protein B to induce the conforma- tional change in t he hydroxylase w hereby it exer ts its e ffect on catalysis. It is also possible that one or more of these residues is directly involved in the pathway for electron transfer between the reductase and the hydroxylase. Precise assignment of the essential N-terminal residues is problem- atic because not all the truncates retained the initiating methionine. For instance, i t is difficult to assess the role of Tyr7 because truncate 7 h ad the initial methionine but truncate 8 did n ot. NMR a nalysis of protein B from Mc. capsulatus (Bath) in the presence of the hydroxylase indicated that t he structured co re region of protein B interacted with the hydroxylase but gave no indication of the involvement of the N-terminus [23]. This was difficult to reconcile with the observed critical importance o f the N-terminal region in the functional [26] and physical [16] interaction o f protein B with the hydroxylase. O ne possibility was that the structure of the c ore r egion was different in proteins B and B¢.The available structural data, however, lend litt le weight to this theory. SAXS data suggested elongation o f the overall structure of protein B on truncation [22], but CD and fluorescence spectroscopy showed that any change in conformation on truncation must be extremely slight. Recent NMR results with the sMMO system from Ms. t richosporium OB3b [42], however, have shown that the N-terminal region of protein B does i ndeed interact with the hydroxylase. In the presence o f the hydroxylase, NMR signals due to His4 (equivalent to Ser4 in the Mc. capsulatus system) and Tyr7 (which is conserved in both Ms. trichos- porium and Mc. capsulatus) broadened, indicating interac- tion with the hydroxylase. T hese assignments a re consistent with our incremental truncation studies, w hich showed that the f unctionally important residues lay in the region Ser4– Tyr7. Signals due to His32, which is toward the inner end of the flexible N-terminal region, were also perturbed by the presence of the hydroxylase, again indicative of binding [42], although analysis o f the function of this residue is not accessible v ia the incremental truncation m ethod u sed here. The NMR study indicated that the isolated 29 N-terminal residues of protein B bound to the hydroxylase in a manner that was competitive w ith the full-length protein B [42]. C onversely, an artificially synthesized dodecapeptide corresponding to amino acids 1–12 of protein B (SVNSNAYDAGIM, which was purified to homogeneity and confirmed b y ESI-MS to have a molecular mass of 1241.3 D a), did not restore function to protein B¢ [43]. Thus it is possible that t he N-terminus and core of protein B can bind independently to the hydroxylase, but the covalent Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1841 connection between them is needed to induce the required conformational change in the hydroxylase. It is also intriguing that the capacity of protein B to activate the h ydroxylase d uring the whole-complex sMMO reaction was not affected by changes to the amino acids flanking the site of cleavage for protein B¢ formation, b ut the inhibitory effect of intact protein B in th e p eroxide shunt reaction was diminished by s uch mutations. This suggests a fundamental difference in the nature of the interactions required for the stimulatory and inhibitory effects o f protein B. Either the two types of effect result from binding at different sites on the hydroxylase, or the conformational change that the mutant forms elicit in the hydroxylase is different from that elicited by the wild-type such that the inhibitory effect alone is diminished. Biological significance of truncation All known s MMOs require a protein B component for f ull activity, a nd o ther homologous binuclear iron active-centre mono-oxygenases also have an essential regulatory protein that is, like protein B of sMMO, a small protein without prosthetic groups [44]. The susceptibility of protein B and other regulatory p roteins (such as the regulatory protein o f alkene monooxygenase from Rhodococcus rhodochrous B-276 (S. C. Gallagher & H. Dalton, unpublished observa- tions) to inactivation by proteolytic degradation offers a mechanism by which their activity, and hence the activity of the whole enzyme complex, could be controlled. It also offers an explanation for the persistence of the regulatory components during evolution. In t he c ase o f sMMO, autocatalytic cleav age may ensure that the half-life of active protein B is s hort, and so the activity of protein B could be controlled at the transcrip- tional or translational levels with minimal lag time. Alternatively, other factors in the cell may control the rate of autoproteolysis of protein B, in response to environ- mental factors or the metabolic state of the cell. It is interesting to note that the protein B of Ms. trichosporium OB3b is much less susceptible to cleavage tha n that of Mc. capsulatus (Bath) and that the truncated form of the Ms. trichosporium protein is not observed in vivo during growth using sMMO (A. J. Callaghan, S. E. Slade & H. Dalton, unp ublished observations). Also, although protein BfromMethylocystis sp. strain M does undergo N-terminal truncation, this is prevented b y protease inhibitors [45]. Thus, it may be that the importance o f truncation of protein B in determining sMMO activity differs among the sMMO- expressing methanotrophs. As proteins B and B¢ were observed in vivo at comparable levels during steady-state g rowth of Mc. capsulatus (Bath), truncation of protein B is evidently a significant factor in determining the amount of active protein B in the cell. It was suspected that t runcation of p rotein B p layed a role in the observed rapid inactivation of sMMO when the copper concentration of the medium was increased, i n advance of the induction of the copper-dependent pMMO via the copper switch. However, the abundance of proteins B and B¢ was unchanged even after d etectable sMMO activity had been lost and pMMO induced (data not shown), so it appears t hat truncation of protein B does not play a role in controlling sMMO activity during the copper switch. It remains to b e demonstrated whether regulation of sMMO by other factors, such as starvation and other metabolic stresses, is effected in vivo via t runcation of protein B. ACKNOWLEDGEMENT This work was funded through a Biotechno logy and Biological Sciences Research Council (BBSRC) Studentship to A. J. C. REFERENCES 1. Hanson, R.S. & Hanson, T.E. (1996) Methanotrophic bacteria. Microbiol. Rev. 60, 439–471. 2. Stanley, S.H., Prior, S.D., Leak, D.J. & Dalton, H. (1983) Copper stress underlies the fundamental change in intracellular location of methane monooxygenase in methane-oxidizing organisms: studies in batch and continuous cultures. Biotechnol. Lett. 5, 487 –492. 3. Green, J . & Dalton, H . (1985) Protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath): a novel regulatory protein of enzyme activity. J. Biol. Chem. 260, 15795– 15801. 4. Dalton, H., Smith, D.D.S. & Pilkington, S.J. (1990) Towards a unified mechanism of biological methane oxidation. FEMS Microbiol. Rev. 87, 201–208. 5. Woodland, M.P., Patil, D.S., Cammack, R. & Dalton, H. (1 986) Electron-spin-resonance studies of protein A of the soluble methane monooxygenase from Methylococcus capsulatus (Bath). Biochim. Bioph ys. Acta 873, 237–242. 6. Rosenzweig, A.C., Frederick, C.A., Lippard, S.J. & Nordlund, P. (1993) Cry stal structure of a b acterial nonheme iron hydroxylase that catalyzes t he biologic al oxidation of methane. Nature 36 6 , 537–543. 7. Colby, J. & D alton, H. (1978) Resolution of the m ethane mono- oxygenase of Methylococcus capsulatus (Bath ) into three c ompo- nents. Biochem. J. 171, 461–468. 8. Lund, J ., Woodland, M.P. & Dalton, H. (1 985) Electron-transfer reactions in the soluble m ethane monooxygenase of Methylo- coccus ca psulatus (Bath). Eur. J. Biochem. 147, 297–305. 9. Liu, K.E. & Lipp ard, S.J. (1991) Redox properties of the hydro- xylase component of methane monooxygenase from Methylo- coccus capsu lat us (Bath): effects of protein B, reductase, and substrate. J. Biol. Chem. 266 , 12836–12839. 10. Kazlauskaite, H ., Hill, H.A.O., Wilkins, P.C. & Dalton, H. (1996) Direct electrochemistry of the hydroxylase of soluble methane monooxygenase from Methylococcus capsulatus (Bath). Eur. J. Biochem. 241, 552– 556. 11. Liu, Y., Nesheim, J.C., Lee, S K. & Lipscomb, J.D. (1995) Gating effects of component B on oxygen activation by the methane monooxygenase hydroxylase component. J. Biol. C hem. 270, 24662–24665. 12. Liu, K.E., Valentine, A.M., Wang, D.L., Huynh, B.H., Edmondson, D.E., Salifoglou, A. & Lippard, S.J. (1995) Ki netic and spectroscopic characterization of intermediates a nd compo- nent inte ractions in reactions o f m ethan e m onooxygenase from Methylococ cus capsulatus (Bath). J. Am. Chem. Soc. 117, 10174– 10185. 13. Valentine, A.M., S tahl, S.S. & Lippard, S.J. (1999) Mechanistic studies of the reaction of reduced methane monooxygenase hydroxylase with dioxygen and substrates. J. Am . Chem. Soc. 121, 3876–3887. 14. Jiang, Y., Wilkins, P.C. & Dalton, H. (1993) Activation of the hydroxylase o f s MMO from Methylococcus capsulatus (Bath) by hydrogen peroxide. Biochim. Biophys. Acta 116 3, 105–112. 15. Froland, W.A., Andersson, K.K., Lee, S K ., Liu, Y. & L ipscom b, J.D. (1992) Methane m onooxygenase component B and reductase alter the r egioselectivity of the hydroxylase component-catalyzed reactions: a novel role for protein–protein interactions in an oxygenase mechanism. J. Biol. Chem. 267, 17588–17597. 1842 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002 16. Lloyd, J.S., Bhambra, A., Murrell, J.C. & Dalton, H. (1997) Inactivation of the regulatory protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath) by pro- teolysis can be overcome by a G ly to Gin modification. Eur. J. Biochem. 248, 72–79. 17. Gassner, G .T. & L ippard, S.J. (1999) Component interactions in the s oluble m ethane m onooxygenase system from Methylococcus capsulatus (Bath). Biochemistry 38, 12768–12785. 18. Fox, B.G., Liu, Y., Dege, J.E. & Lipscomb, J.D. (1991) Complex formation between the protein components of methane monooxygenase from Methylosinus trichosporium OB3b: i dentifi- cation of sites of component interaction. J . Biol. Chem. 266, 540– 550. 19. Davydov, A ., Davydov, R., Gra ¨ slund, A., Lipscomb, J.D. & Andersson, K.K . (1997) Radiolytic re duction of methane mon o- oxygenase dinuclear iron cluster at 77 K: EPR evidence for con- formational change upon reduction or binding of component B to the diferric s tate. J. Biol. Chem. 272, 7022–7026. 20. Davydov, R., Valentine, A.M., Konar-Panicucci, S., Hoffman, B.M. & Lippard, S.J. (1999) An EPR study of the dinuclear iron site in the soluble methane monooxygenase from Methylococcus capsulatus (Bath) re duced by one electron at 77 K: the effe cts o f component i nteraction s and the binding of small m olecules to the diiron ( III) center. Biochemist ry 38, 4188–4197. 21. Coates-Pulver, S., Froland, W.A., L ipscomb, J.D. & Solomon, E.I. (1997) Ligand fi eld c ircular d ichroism and m agnetic c ircular dichroism studies of component B and substrate binding to the hydroxylase component of m ethane monooxygenase. J. Am. Chem. Soc. 119, 387–395. 22. Gallagher, S.C., Callaghan,A.J., Zhao, J., Dalton, H. & Trewhella, J. (1999) Global conformational changes control the reactivity of methane monooxygenase. Biochemistry 38, 6 752–6760. 23. Walters, K .J., Gassner, G.T., Lippard, S.J . & W agner, G. ( 1999) Structure of t he soluble m ethane monooxygenase regulatory protein B. Proc. N atl Acad. Sci. USA 96, 7877–7882. 24.Rosenzweig,A.C.,Brandstetter,H.,Whittington,D.A., Nordlund, P., Lippard, S.J. & Frederick, C.A. (1997) Crystal structures of the methane monooxygenase h ydroxylase from Methylococcus capsulatus (Bath): implications for substrate gating and component interactions. Proteins 29 , 141–152. 25. Elango, N., Radhakrishnan, R., Froland, W.A., Wallar, B.J., Earhart, C.A., Lipscomb, J.D. & Ohlendorf, D.H. (1997) Crystal structure of the hydroxylase component of methane mono- oxygenase from Methylosinus trichosporium OB3b. Prot. Sci. 6, 556–568. 26. Pilkington, S.J., Salmond, G.P.C., Murrell, J.C. & Dalton, H. (1990) Identification of the gene encoding the regulatory protein B of soluble methane m onooxyge nase. FEMS Microbiol. Lett. 72, 345–348. 27. Brandstetter, H., W hittington , D.A., Lippard, S.J. & Frederick, C.A. (1999) Mutational and structural analyses o f the regu latory protein B of soluble methane monooxygenase from Methylococcus capsulatus (Bath). Chem. Biol. 6, 441–449. 28.Maniatis,T.,Fritsch,E.F.&Sambrook,J.(1982)Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Labora tory Press, New York. 29. Pilkington, S.J. & Dalton, H. (1990) Soluble methane mono- oxygenase from Methylococcus capsulatus Bath. Methods Enzymol. 188 , 181–190. 30. Whittaker, J.R. & Granum, P.E. (1980) An absolute method for protein d etermination b ased o n d iffe rences o f a bsorbance at 235 and 280nm. Anal. Biochem. 109 , 156–159. 31. Scopes, R.K. (1974) Measure ment of protein by sp ectrophoto m- etry at 205 nm. Anal. Biochem. 59 , 277–282. 32. Bradford, M.M. (1976) A r apid and sensitive method for t he quantitation of microgram quantities of protein utilizing the principle of dye bin ding. Anal. Biochem. 72 , 248–254. 33.Bodrossy,L.,Murrell,J.C.,Dalton,H.,Kalman,M.,Puskas, L.G. & Kovacs, K.L. (1995) Heat-tolerant methanotrophic bac- teria f rom the hot-wat er effluent of a natural-gas field. Appl. Environ. Mi crobiol. 61, 3549–3555. 34. Balls, A.K. & Wood, H.N. (1956) Acetyl chymotrypsin and its reaction with ethan ol. J. Biol. Chem. 219, 2 45–256. 35. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly o f th e h ead o f b acteriophage T4. Nature 227, 680– 685. 36. Perler, F.B. (1998) Breaking up is easy with esters. Nat. Struct. Biol. 5, 249–252. 37. Stoddard, B.L. & Pietrokovski, S. (1998 ) B reaking up i s h ard t o do. Nat. Struct. Biol. 5, 3–5. 38. Duggleby, H.J., T olley, S.P., H ill, C.P., Dodson, E.J., D odson, G. & Moody, P .C. (1995) Penicillin acylase has a single-amino-acid catalytic center. Nature 373, 264–268. 39. Guan,C.D.,Cui,T.,Rao,V.,Liao,W.,Benner,J.,Line,C.L.& Comb, D. (1996) Activation of glycosylasparaginase: formation of active N-terminal threonine by intramolecular autoproteolysis. J. Biol. Chem. 27 1, 1732–1737. 40. Ramjee, M.K., Genschel, U., Abell, C. & Smith, A.G. (1997) Escherichia coli L -aspartate-a-decarboxylase: preprotein process- ing and observation of r eaction i ntermediates by e lectro spray mass spectrometry. Biochem. J. 323 , 661–669. 41. Nielsen, A.K., Gerdes, K., Dega, H. & Murrell, J.C. (1996) Regulation of bacterial methane oxid ation: transcription of the soluble methane monooxygenase operon of Methylococcus capsulatus (Bath) is repressed by copper ions. Microbiology 142, 1289–1296. 42. Chang, S L., Wallar, B.L., Lipscomb, J.D. & Mayo, K.H. (2001) Residues in Methylosinus trichosporium OB3b methane mono- oxygenase component B involved in molecular interactions with reduced- and oxidized-hydroxylase com ponent: a role for t he N-terminus. Biochemistry 40, 9539–9551. 43. Bhambra, A. (1996) The regulatory protein of methane mo no- oxygenase. PhD Thesis, U niversity of Warwick. 44. Zhou, N.Y., Jenkins, A., Chion, C.K.N.C.K. & Leak, D.J. (1999) The alkene monooxygenase from Xanthobacter strain Py2 is closely related to aromatic monooxygenases and ca talyzes aromatic monohydroxylation of benzene, toluene, and phenol. Appl. Environ. Microbiol. 65 , 1589–1595. 45. Shinohara, Y., Uchiyama, H., Yagi, O . & Kusakabe, I. (1998) Purification and characterization of component B of a soluble methane monooxygenase from Methylocystis sp. M. J. Ferment. Bioeng. 85 , 37–42. Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1843 . Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase Anastasia J. Callaghan*, Thomas J. Smith†, Susan E. Slade and. a mixture of proteins B and B .The relative abundance of p roteins B and B was assessed b y using SDS/PAGE and electrospray ionization (ESI)-MS. Incubation of the purified protein B /B mix at. calculated masses of proteins B, B and B ¢. On chromatofocusing the sample could be readily resolved into proteins B, B and B ¢. Immediate SDS/ PAGE analysis of the protein B fraction at this